Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000803065:

Variant ID: vg1000803065 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 803065
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.04, others allele: 0.00, population size: 28. )

Flanking Sequence (100 bp) in Reference Genome:

TTAAGTTTGATCTACTAAGTCGAGCTTAGAATCATAATCACTAGTCTGCTTGTTGATTGCCAATAAGGGTTTCATTGGGGTTTTAGCCGATGAGATATCT[G/A]
GATATTGCATCGGCTTATAAGGATTGCATACAAGTTGGATTTAGCCGATAAGAATAAAGGTTTTACTATTTATCTAATCATTTAGAAAAAAAAAAGTGTG

Reverse complement sequence

CACACTTTTTTTTTTCTAAATGATTAGATAAATAGTAAAACCTTTATTCTTATCGGCTAAATCCAACTTGTATGCAATCCTTATAAGCCGATGCAATATC[C/T]
AGATATCTCATCGGCTAAAACCCCAATGAAACCCTTATTGGCAATCAACAAGCAGACTAGTGATTATGATTCTAAGCTCGACTTAGTAGATCAAACTTAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.60%	23.80%	0.42%	48.24%	NA
All Indica	2759	19.40%	32.20%	0.36%	48.02%	NA
All Japonica	1512	48.60%	2.60%	0.40%	48.41%	NA
Aus	269	2.20%	36.10%	0.37%	61.34%	NA
Indica I	595	19.00%	45.20%	0.34%	35.46%	NA
Indica II	465	4.90%	20.40%	0.86%	73.76%	NA
Indica III	913	21.80%	30.00%	0.11%	48.08%	NA
Indica Intermediate	786	25.60%	31.80%	0.38%	42.24%	NA
Temperate Japonica	767	77.80%	0.40%	0.52%	21.25%	NA
Tropical Japonica	504	5.80%	2.80%	0.40%	91.07%	NA
Japonica Intermediate	241	45.20%	9.10%	0.00%	45.64%	NA
VI/Aromatic	96	2.10%	87.50%	1.04%	9.38%	NA
Intermediate	90	26.70%	16.70%	2.22%	54.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000803065	G -> A	LOC_Os10g02250.1	upstream_gene_variant ; 3697.0bp to feature; MODIFIER	silent_mutation	Average:23.724; most accessible tissue: Callus, score: 56.866	N	N	N	N
vg1000803065	G -> A	LOC_Os10g02260.1	downstream_gene_variant ; 2598.0bp to feature; MODIFIER	silent_mutation	Average:23.724; most accessible tissue: Callus, score: 56.866	N	N	N	N
vg1000803065	G -> A	LOC_Os10g02260.2	downstream_gene_variant ; 2604.0bp to feature; MODIFIER	silent_mutation	Average:23.724; most accessible tissue: Callus, score: 56.866	N	N	N	N
vg1000803065	G -> A	LOC_Os10g02250-LOC_Os10g02260	intergenic_region ; MODIFIER	silent_mutation	Average:23.724; most accessible tissue: Callus, score: 56.866	N	N	N	N
vg1000803065	G -> DEL	N	N	silent_mutation	Average:23.724; most accessible tissue: Callus, score: 56.866	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000803065	NA	1.23E-06	mr1098_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000803065	3.93E-06	3.93E-06	mr1230_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000803065	2.97E-06	6.12E-07	mr1415_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000803065	NA	1.73E-06	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000803065	NA	9.73E-06	mr1884_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251