Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000754147:

Variant ID: vg1000754147 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 754147
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.69, A: 0.31, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

TGATAACTCGACGAATTACATAAACAAGATTAGAGTGTCATAAAGATGGAAGCACTAATCCCAAGAACGCAAGCCGTCATAACAAGTTTTACCTCTTGTT[A/G]
AAGATCAAAACCGATGCAGCTCAACCCGAAAGCAAGAACTCGTCGAAATAAAACTAAAGTGAAAGGGTGGCGATGCGCCGAAATTGTATTGAACGTGTGT

Reverse complement sequence

ACACACGTTCAATACAATTTCGGCGCATCGCCACCCTTTCACTTTAGTTTTATTTCGACGAGTTCTTGCTTTCGGGTTGAGCTGCATCGGTTTTGATCTT[T/C]
AACAAGAGGTAAAACTTGTTATGACGGCTTGCGTTCTTGGGATTAGTGCTTCCATCTTTATGACACTCTAATCTTGTTTATGTAATTCGTCGAGTTATCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.80%	16.60%	4.04%	36.54%	NA
All Indica	2759	54.40%	0.80%	6.71%	38.09%	NA
All Japonica	1512	8.70%	48.80%	0.20%	42.33%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	64.20%	1.00%	2.02%	32.77%	NA
Indica II	465	27.30%	1.30%	6.45%	64.95%	NA
Indica III	913	56.80%	0.20%	9.97%	32.97%	NA
Indica Intermediate	786	60.20%	1.00%	6.62%	32.19%	NA
Temperate Japonica	767	9.90%	78.20%	0.26%	11.60%	NA
Tropical Japonica	504	3.60%	6.00%	0.20%	90.28%	NA
Japonica Intermediate	241	15.40%	44.80%	0.00%	39.83%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	40.00%	16.70%	3.33%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000754147	A -> G	LOC_Os10g02180.1	upstream_gene_variant ; 2443.0bp to feature; MODIFIER	silent_mutation	Average:16.718; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg1000754147	A -> G	LOC_Os10g02190.1	downstream_gene_variant ; 1564.0bp to feature; MODIFIER	silent_mutation	Average:16.718; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg1000754147	A -> G	LOC_Os10g02200.1	downstream_gene_variant ; 145.0bp to feature; MODIFIER	silent_mutation	Average:16.718; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg1000754147	A -> G	LOC_Os10g02190-LOC_Os10g02200	intergenic_region ; MODIFIER	silent_mutation	Average:16.718; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg1000754147	A -> DEL	N	N	silent_mutation	Average:16.718; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000754147	1.31E-07	NA	mr1310	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147	NA	4.82E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147	NA	4.11E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147	NA	8.11E-12	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147	NA	3.13E-08	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147	6.15E-08	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147	7.98E-07	NA	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147	NA	1.77E-08	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147	4.58E-06	NA	mr1959	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147	NA	2.64E-06	mr1968	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147	2.00E-08	NA	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147	3.51E-09	NA	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147	NA	4.44E-06	mr1549_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147	NA	3.72E-06	mr1951_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147	7.46E-06	NA	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147	NA	2.65E-06	mr1968_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251