Variant ID: vg1000736288 (JBrowse) | Variation Type: SNP |
Chromosome: chr10 | Position: 736288 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, C: 0.34, others allele: 0.00, population size: 85. )
CTGACCCTAGCCCCCAGCCGTGAAGTTGGAAAAATCCATTTCCGATTACACGGCTTGGTTAATACGCACGGCGAGAACTCTTACATGACCAGATCTTACA[C/T]
GGTCTTTCGTCTCTGAAGGATTCGACAAGGCCTTATCAGCTCTGGGCGTCCCCAGCCGAAGTTCCCTTAGGTTCCTCGGAGGCCTTGTCAAGACGGCGTA
TACGCCGTCTTGACAAGGCCTCCGAGGAACCTAAGGGAACTTCGGCTGGGGACGCCCAGAGCTGATAAGGCCTTGTCGAATCCTTCAGAGACGAAAGACC[G/A]
TGTAAGATCTGGTCATGTAAGAGTTCTCGCCGTGCGTATTAACCAAGCCGTGTAATCGGAAATGGATTTTTCCAACTTCACGGCTGGGGGCTAGGGTCAG
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 47.10% | 10.40% | 5.01% | 37.47% | NA |
All Indica | 2759 | 51.10% | 4.60% | 4.89% | 39.47% | NA |
All Japonica | 1512 | 51.10% | 7.10% | 1.85% | 40.01% | NA |
Aus | 269 | 1.90% | 56.50% | 25.28% | 16.36% | NA |
Indica I | 595 | 66.40% | 0.30% | 2.35% | 30.92% | NA |
Indica II | 465 | 27.50% | 1.70% | 6.24% | 64.52% | NA |
Indica III | 913 | 50.30% | 5.90% | 7.01% | 36.80% | NA |
Indica Intermediate | 786 | 54.30% | 7.90% | 3.56% | 34.22% | NA |
Temperate Japonica | 767 | 79.30% | 9.40% | 1.43% | 9.91% | NA |
Tropical Japonica | 504 | 9.90% | 1.00% | 1.19% | 87.90% | NA |
Japonica Intermediate | 241 | 47.30% | 12.40% | 4.56% | 35.68% | NA |
VI/Aromatic | 96 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
Intermediate | 90 | 35.60% | 21.10% | 6.67% | 36.67% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1000736288 | C -> T | LOC_Os10g02150.1 | downstream_gene_variant ; 372.0bp to feature; MODIFIER | silent_mutation | Average:29.707; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 | N | N | N | N |
vg1000736288 | C -> T | LOC_Os10g02160.1 | downstream_gene_variant ; 364.0bp to feature; MODIFIER | silent_mutation | Average:29.707; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 | N | N | N | N |
vg1000736288 | C -> T | LOC_Os10g02170.1 | downstream_gene_variant ; 3369.0bp to feature; MODIFIER | silent_mutation | Average:29.707; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 | N | N | N | N |
vg1000736288 | C -> T | LOC_Os10g02150-LOC_Os10g02160 | intergenic_region ; MODIFIER | silent_mutation | Average:29.707; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 | N | N | N | N |
vg1000736288 | C -> DEL | N | N | silent_mutation | Average:29.707; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1000736288 | NA | 7.62E-06 | mr1040 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1000736288 | NA | 1.94E-08 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1000736288 | 1.25E-06 | 6.46E-11 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1000736288 | 3.27E-06 | NA | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1000736288 | NA | 1.54E-06 | mr1968 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1000736288 | 3.13E-09 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1000736288 | 2.02E-10 | NA | mr1310_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1000736288 | NA | 1.20E-07 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1000736288 | NA | 2.02E-06 | mr1550_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1000736288 | NA | 3.50E-08 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1000736288 | 6.85E-06 | NA | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1000736288 | NA | 9.22E-07 | mr1968_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |