Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000730968:

Variant ID: vg1000730968 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 730968
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

GACTATGATTATTACAAGTAACATATAAACTATTAGTACGGTTCTCTCTACTATAATCTTTCCACGGGATTAAATAAATACGATTCCCTTGGAATACTCT[C/T,A]
GGGTGAAATGCTACAATTGTATATCTGTGCGCTTGCGGATGAACTCTGTAACCACAATATACTAAGAGTATTTCAGCGCCATTGCTGGGAATTAAATTTC

Reverse complement sequence

GAAATTTAATTCCCAGCAATGGCGCTGAAATACTCTTAGTATATTGTGGTTACAGAGTTCATCCGCAAGCGCACAGATATACAATTGTAGCATTTCACCC[G/A,T]
AGAGTATTCCAAGGGAATCGTATTTATTTAATCCCGTGGAAAGATTATAGTAGAGAGAACCGTACTAATAGTTTATATGTTACTTGTAATAATCATAGTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.40%	3.20%	1.35%	0.00%	A: 0.04%
All Indica	2759	99.80%	0.10%	0.11%	0.00%	NA
All Japonica	1512	86.60%	9.60%	3.84%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.60%	0.20%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.00%	0.25%	0.00%	NA
Temperate Japonica	767	82.70%	10.80%	6.52%	0.00%	NA
Tropical Japonica	504	97.80%	2.20%	0.00%	0.00%	NA
Japonica Intermediate	241	75.50%	21.20%	3.32%	0.00%	NA
VI/Aromatic	96	94.80%	3.10%	2.08%	0.00%	NA
Intermediate	90	95.60%	1.10%	1.11%	0.00%	A: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000730968	C -> T	LOC_Os10g02150.1	upstream_gene_variant ; 1981.0bp to feature; MODIFIER	silent_mutation	Average:43.58; most accessible tissue: Minghui63 young leaf, score: 69.4	N	N	N	N
vg1000730968	C -> T	LOC_Os10g02140-LOC_Os10g02150	intergenic_region ; MODIFIER	silent_mutation	Average:43.58; most accessible tissue: Minghui63 young leaf, score: 69.4	N	N	N	N
vg1000730968	C -> A	LOC_Os10g02150.1	upstream_gene_variant ; 1981.0bp to feature; MODIFIER	silent_mutation	Average:43.58; most accessible tissue: Minghui63 young leaf, score: 69.4	N	N	N	N
vg1000730968	C -> A	LOC_Os10g02140-LOC_Os10g02150	intergenic_region ; MODIFIER	silent_mutation	Average:43.58; most accessible tissue: Minghui63 young leaf, score: 69.4	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000730968	1.36E-09	NA	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000730968	NA	5.96E-06	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000730968	1.43E-10	NA	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000730968	6.46E-10	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000730968	4.80E-07	2.22E-09	mr1959	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000730968	3.06E-12	NA	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000730968	2.43E-07	NA	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251