Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000661364:

Variant ID: vg1000661364 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 661364
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACAATGACGGTTCTGTCCACCATCCATTGTGATCCCAAGGATAGCTTCCCGCCATTGGGTCGTTATGGTTTTCTGAGGACGTCCATATTCCCGCCTCTCA[A/G]
GAAGTGGCTCCATCAGCATAAAAATCATCATGCAATATCCCATCCCACACAAGTTAAAGAATTTAGAGTCTAGCCAAGTGTAATACATGTCCCGGTGCTC

Reverse complement sequence

GAGCACCGGGACATGTATTACACTTGGCTAGACTCTAAATTCTTTAACTTGTGTGGGATGGGATATTGCATGATGATTTTTATGCTGATGGAGCCACTTC[T/C]
TGAGAGGCGGGAATATGGACGTCCTCAGAAAACCATAACGACCCAATGGCGGGAAGCTATCCTTGGGATCACAATGGATGGTGGACAGAACCGTCATTGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	20.40%	1.40%	17.67%	60.50%	NA
All Indica	2759	6.50%	0.00%	21.96%	71.58%	NA
All Japonica	1512	49.50%	4.40%	1.52%	44.51%	NA
Aus	269	2.60%	0.00%	53.16%	44.24%	NA
Indica I	595	4.00%	0.00%	11.09%	84.87%	NA
Indica II	465	6.00%	0.00%	27.53%	66.45%	NA
Indica III	913	5.60%	0.00%	26.62%	67.80%	NA
Indica Intermediate	786	9.50%	0.00%	21.50%	68.96%	NA
Temperate Japonica	767	79.40%	8.00%	0.52%	12.13%	NA
Tropical Japonica	504	6.20%	0.00%	1.79%	92.06%	NA
Japonica Intermediate	241	45.20%	2.50%	4.15%	48.13%	NA
VI/Aromatic	96	6.20%	0.00%	42.71%	51.04%	NA
Intermediate	90	26.70%	1.10%	24.44%	47.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000661364	A -> G	LOC_Os10g02040.2	upstream_gene_variant ; 2457.0bp to feature; MODIFIER	silent_mutation	Average:8.935; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N
vg1000661364	A -> G	LOC_Os10g02050.1	upstream_gene_variant ; 2254.0bp to feature; MODIFIER	silent_mutation	Average:8.935; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N
vg1000661364	A -> G	LOC_Os10g02040.1	upstream_gene_variant ; 2457.0bp to feature; MODIFIER	silent_mutation	Average:8.935; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N
vg1000661364	A -> G	LOC_Os10g02040-LOC_Os10g02050	intergenic_region ; MODIFIER	silent_mutation	Average:8.935; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N
vg1000661364	A -> DEL	N	N	silent_mutation	Average:8.935; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000661364	4.74E-06	NA	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000661364	9.12E-10	4.33E-14	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000661364	9.09E-06	NA	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000661364	1.06E-09	5.14E-16	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000661364	1.11E-08	NA	mr1926	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000661364	1.22E-10	1.66E-18	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000661364	1.57E-07	1.03E-09	mr1959	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000661364	8.71E-10	NA	mr1310_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000661364	4.12E-15	6.34E-26	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000661364	1.17E-09	6.32E-16	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251