Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000583028:

Variant ID: vg1000583028 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 583028
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCAAAGCTTGCCCTAATTAAATAAATAATTAATTCGACGAAGACTAGGAACGACCAATGATATCTATTGGCCAACCATATAACACTGTGGAACTGCATAT[C/T]
GACCAGTATATATGAAAAGTCACGGAGGAGGCCAGCAGCCAGCAGCCAGCAGCCAGCAGGTATGTATGTATGTGTGTTTATAGCAAATCCGTTATATTAT

Reverse complement sequence

ATAATATAACGGATTTGCTATAAACACACATACATACATACCTGCTGGCTGCTGGCTGCTGGCTGCTGGCCTCCTCCGTGACTTTTCATATATACTGGTC[G/A]
ATATGCAGTTCCACAGTGTTATATGGTTGGCCAATAGATATCATTGGTCGTTCCTAGTCTTCGTCGAATTAATTATTTATTTAATTAGGGCAAGCTTTGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.80%	16.80%	0.11%	1.38%	NA
All Indica	2759	99.40%	0.50%	0.07%	0.00%	NA
All Japonica	1512	46.30%	49.30%	0.20%	4.23%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	99.20%	0.70%	0.17%	0.00%	NA
Indica II	465	99.40%	0.40%	0.22%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.00%	1.00%	0.00%	0.00%	NA
Temperate Japonica	767	13.60%	78.50%	0.39%	7.56%	NA
Tropical Japonica	504	93.30%	6.70%	0.00%	0.00%	NA
Japonica Intermediate	241	52.30%	45.20%	0.00%	2.49%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	81.10%	17.80%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000583028	C -> T	LOC_Os10g01920.1	5_prime_UTR_premature_start_codon_gain_variant ; LOW	silent_mutation	Average:67.687; most accessible tissue: Zhenshan97 root, score: 94.685	N	N	N	N
vg1000583028	C -> T	LOC_Os10g01920.1	5_prime_UTR_variant ; 210.0bp to feature; MODIFIER	silent_mutation	Average:67.687; most accessible tissue: Zhenshan97 root, score: 94.685	N	N	N	N
vg1000583028	C -> T	LOC_Os10g01910.1	upstream_gene_variant ; 1884.0bp to feature; MODIFIER	silent_mutation	Average:67.687; most accessible tissue: Zhenshan97 root, score: 94.685	N	N	N	N
vg1000583028	C -> DEL	N	N	silent_mutation	Average:67.687; most accessible tissue: Zhenshan97 root, score: 94.685	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1000583028	C	T	-0.09	0.02	0.0	-0.01	-0.01	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000583028	6.57E-28	1.05E-49	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000583028	8.22E-12	1.36E-16	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000583028	3.15E-30	3.83E-71	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000583028	1.53E-12	9.11E-20	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000583028	7.73E-07	7.52E-07	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000583028	1.16E-39	3.10E-87	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000583028	2.95E-14	1.89E-23	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000583028	9.59E-18	2.48E-23	mr1959	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000583028	3.24E-09	1.57E-11	mr1959	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000583028	2.98E-46	4.37E-82	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000583028	1.17E-21	8.88E-34	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000583028	9.88E-23	4.94E-34	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000583028	3.13E-12	1.81E-19	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251