Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000551614:

Variant ID: vg1000551614 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 551614
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.72, G: 0.28, others allele: 0.00, population size: 43. )

Flanking Sequence (100 bp) in Reference Genome:

GGCTAGGTGCCGATGACATATCATTTATCTATAGGCCGATGTCATATGTACATTGATCGGCAAGTGTTAATAAGCAAATCAAAACTAAATCTACCCGATC[A/G]
GCTGTAGATATTAATGATATATAATCCTTATATCGATATATACTTAAATCAAGTGATTGGGATAGATCGGTCATCTTGCCGAGACAGTATAAATCACTTA

Reverse complement sequence

TAAGTGATTTATACTGTCTCGGCAAGATGACCGATCTATCCCAATCACTTGATTTAAGTATATATCGATATAAGGATTATATATCATTAATATCTACAGC[T/C]
GATCGGGTAGATTTAGTTTTGATTTGCTTATTAACACTTGCCGATCAATGTACATATGACATCGGCCTATAGATAAATGATATGTCATCGGCACCTAGCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	17.40%	1.70%	16.63%	64.30%	NA
All Indica	2759	1.20%	0.10%	27.76%	70.90%	NA
All Japonica	1512	49.70%	4.80%	0.60%	44.97%	NA
Aus	269	3.70%	0.40%	0.37%	95.54%	NA
Indica I	595	1.50%	0.00%	22.86%	75.63%	NA
Indica II	465	1.70%	0.00%	18.28%	80.00%	NA
Indica III	913	0.30%	0.00%	41.18%	58.49%	NA
Indica Intermediate	786	1.80%	0.40%	21.50%	76.34%	NA
Temperate Japonica	767	78.60%	8.60%	0.13%	12.65%	NA
Tropical Japonica	504	7.30%	0.00%	1.59%	91.07%	NA
Japonica Intermediate	241	46.10%	2.50%	0.00%	51.45%	NA
VI/Aromatic	96	9.40%	0.00%	0.00%	90.62%	NA
Intermediate	90	20.00%	3.30%	11.11%	65.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000551614	A -> G	LOC_Os10g01844.1	upstream_gene_variant ; 2821.0bp to feature; MODIFIER	silent_mutation	Average:13.483; most accessible tissue: Callus, score: 25.831	N	N	N	N
vg1000551614	A -> G	LOC_Os10g01850.1	intron_variant ; MODIFIER	silent_mutation	Average:13.483; most accessible tissue: Callus, score: 25.831	N	N	N	N
vg1000551614	A -> DEL	N	N	silent_mutation	Average:13.483; most accessible tissue: Callus, score: 25.831	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000551614	1.12E-06	NA	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000551614	NA	8.59E-10	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000551614	1.89E-10	NA	mr1310_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000551614	1.15E-09	NA	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000551614	NA	2.12E-06	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000551614	NA	2.19E-08	mr1549_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000551614	NA	3.79E-07	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000551614	4.74E-07	NA	mr1959_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251