Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000475572:

Variant ID: vg1000475572 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 475572
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTTAGAGAATGGATAGAGGACGAGAAGAGAGATTTCCAAGAGGAGATTACATGACGATCATCTTTTTTAAACCTCTCTGCCCACAGTGAAGCATCTTC[G/A]
ATACATTTCGTGAGCAAGTGACGGAGCGAGATGTCTTCACGTCTAAAGACCACGTCGTGGCGATGATTCCACAAATTCCAAAAGCACAGCAGATAGAAAA

Reverse complement sequence

TTTTCTATCTGCTGTGCTTTTGGAATTTGTGGAATCATCGCCACGACGTGGTCTTTAGACGTGAAGACATCTCGCTCCGTCACTTGCTCACGAAATGTAT[C/T]
GAAGATGCTTCACTGTGGGCAGAGAGGTTTAAAAAAGATGATCGTCATGTAATCTCCTCTTGGAAATCTCTCTTCTCGTCCTCTATCCATTCTCTAAATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.80% 15.00% 0.40% 6.83% NA
All Indica  2759 96.10% 0.30% 0.14% 3.41% NA
All Japonica  1512 54.10% 44.50% 0.86% 0.53% NA
Aus  269 36.40% 0.40% 0.00% 63.20% NA
Indica I  595 99.50% 0.30% 0.17% 0.00% NA
Indica II  465 98.90% 0.40% 0.00% 0.65% NA
Indica III  913 93.90% 0.20% 0.22% 5.70% NA
Indica Intermediate  786 94.50% 0.40% 0.13% 4.96% NA
Temperate Japonica  767 24.80% 73.80% 1.30% 0.13% NA
Tropical Japonica  504 94.20% 5.80% 0.00% 0.00% NA
Japonica Intermediate  241 63.50% 32.40% 1.24% 2.90% NA
VI/Aromatic  96 46.90% 9.40% 1.04% 42.71% NA
Intermediate  90 71.10% 16.70% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000475572 G -> A LOC_Os10g01730.1 missense_variant ; p.Asp53Asn; MODERATE nonsynonymous_codon ; D53N Average:69.397; most accessible tissue: Zhenshan97 flag leaf, score: 89.49 unknown unknown TOLERATED 0.78
vg1000475572 G -> DEL LOC_Os10g01730.1 N frameshift_variant Average:69.397; most accessible tissue: Zhenshan97 flag leaf, score: 89.49 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1000475572 G A -0.01 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000475572 NA 8.63E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000475572 6.33E-21 1.64E-41 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000475572 9.07E-10 4.57E-14 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000475572 5.05E-27 8.17E-64 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000475572 9.13E-12 8.01E-19 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000475572 1.82E-08 5.39E-08 mr1498 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000475572 9.22E-32 1.19E-73 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000475572 1.24E-11 4.28E-20 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000475572 1.27E-16 1.30E-22 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000475572 5.15E-10 2.09E-12 mr1959 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000475572 NA 3.35E-06 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000475572 3.70E-37 4.57E-71 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000475572 3.20E-16 7.05E-27 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000475572 1.05E-21 1.31E-33 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000475572 2.45E-11 2.70E-19 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251