| Variant ID: vg1000239130 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 239130 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATTCTTCAACACCGAAAATGATATGGAAGACACTTCAAAAGTTCATAGGTACAAGTATAGCTTGGAATACTTTCTATGTTTGCATCATTATACATGAAGC[C/T]
TTTGCTCTATTGAATTCAATGAGCTTTACTCAGGGACAAGTAAAGGATAAGTGTTGCGGTGTTGTTGACGGTCGTTAAGTGCAAACTTTAACCGAACTCC
GGAGTTCGGTTAAAGTTTGCACTTAACGACCGTCAACAACACCGCAACACTTATCCTTTACTTGTCCCTGAGTAAAGCTCATTGAATTCAATAGAGCAAA[G/A]
GCTTCATGTATAATGATGCAAACATAGAAAGTATTCCAAGCTATACTTGTACCTATGAACTTTTGAAGTGTCTTCCATATCATTTTCGGTGTTGAAGAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.90% | 1.00% | 34.93% | 27.15% | NA |
| All Indica | 2759 | 30.00% | 1.50% | 51.65% | 16.85% | NA |
| All Japonica | 1512 | 55.70% | 0.30% | 5.95% | 38.10% | NA |
| Aus | 269 | 8.90% | 0.70% | 35.69% | 54.65% | NA |
| Indica I | 595 | 20.30% | 1.70% | 63.19% | 14.79% | NA |
| Indica II | 465 | 47.50% | 0.60% | 38.28% | 13.55% | NA |
| Indica III | 913 | 23.70% | 2.10% | 53.34% | 20.92% | NA |
| Indica Intermediate | 786 | 34.40% | 1.10% | 48.85% | 15.65% | NA |
| Temperate Japonica | 767 | 85.80% | 0.00% | 1.30% | 12.91% | NA |
| Tropical Japonica | 504 | 11.70% | 0.80% | 12.90% | 74.60% | NA |
| Japonica Intermediate | 241 | 51.90% | 0.00% | 6.22% | 41.91% | NA |
| VI/Aromatic | 96 | 11.50% | 0.00% | 21.88% | 66.67% | NA |
| Intermediate | 90 | 44.40% | 0.00% | 21.11% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000239130 | C -> T | LOC_Os10g01400.1 | upstream_gene_variant ; 4408.0bp to feature; MODIFIER | silent_mutation | Average:8.735; most accessible tissue: Zhenshan97 flower, score: 17.42 | N | N | N | N |
| vg1000239130 | C -> T | LOC_Os10g01390.1 | downstream_gene_variant ; 26.0bp to feature; MODIFIER | silent_mutation | Average:8.735; most accessible tissue: Zhenshan97 flower, score: 17.42 | N | N | N | N |
| vg1000239130 | C -> T | LOC_Os10g01380-LOC_Os10g01390 | intergenic_region ; MODIFIER | silent_mutation | Average:8.735; most accessible tissue: Zhenshan97 flower, score: 17.42 | N | N | N | N |
| vg1000239130 | C -> DEL | N | N | silent_mutation | Average:8.735; most accessible tissue: Zhenshan97 flower, score: 17.42 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000239130 | 1.16E-06 | 1.16E-06 | mr1260 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000239130 | NA | 6.02E-06 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000239130 | NA | 2.41E-06 | mr1570 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000239130 | NA | 2.04E-07 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000239130 | NA | 3.46E-08 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |