Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000058548:

Variant ID: vg1000058548 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 58548
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, G: 0.12, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:

GCTACTTCTCACAGACCACCTGCGCTGCAGCTCGTGCTTGAGCATCTTTACATACAGGTACAATAAAAACTATAAGCCAGCTATAAACATATTTTAAAAA[A/G]
ATAAAGAAAGAGATAGAGCAGCAACAGGCTACAAATTTATAGCCAGCTCCAAAACATAATGTGCATATGATAGGTAGGACTAGATATTAATAATACAGTA

Reverse complement sequence

TACTGTATTATTAATATCTAGTCCTACCTATCATATGCACATTATGTTTTGGAGCTGGCTATAAATTTGTAGCCTGTTGCTGCTCTATCTCTTTCTTTAT[T/C]
TTTTTAAAATATGTTTATAGCTGGCTTATAGTTTTTATTGTACCTGTATGTAAAGATGCTCAAGCACGAGCTGCAGCGCAGGTGGTCTGTGAGAAGTAGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.30%	43.80%	0.63%	0.28%	NA
All Indica	2759	33.00%	66.10%	0.51%	0.36%	NA
All Japonica	1512	96.60%	2.40%	0.86%	0.13%	NA
Aus	269	66.50%	33.10%	0.37%	0.00%	NA
Indica I	595	37.50%	61.80%	0.34%	0.34%	NA
Indica II	465	41.70%	57.00%	0.65%	0.65%	NA
Indica III	913	28.90%	70.40%	0.55%	0.11%	NA
Indica Intermediate	786	29.30%	69.70%	0.51%	0.51%	NA
Temperate Japonica	767	96.70%	1.80%	1.43%	0.00%	NA
Tropical Japonica	504	96.60%	3.20%	0.00%	0.20%	NA
Japonica Intermediate	241	95.90%	2.90%	0.83%	0.41%	NA
VI/Aromatic	96	11.50%	88.50%	0.00%	0.00%	NA
Intermediate	90	60.00%	36.70%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000058548	A -> G	LOC_Os10g01044.1	upstream_gene_variant ; 211.0bp to feature; MODIFIER	silent_mutation	Average:95.162; most accessible tissue: Zhenshan97 young leaf, score: 98.014	N	N	N	N
vg1000058548	A -> G	LOC_Os10g01044.2	upstream_gene_variant ; 211.0bp to feature; MODIFIER	silent_mutation	Average:95.162; most accessible tissue: Zhenshan97 young leaf, score: 98.014	N	N	N	N
vg1000058548	A -> G	LOC_Os10g01044.3	upstream_gene_variant ; 210.0bp to feature; MODIFIER	silent_mutation	Average:95.162; most accessible tissue: Zhenshan97 young leaf, score: 98.014	N	N	N	N
vg1000058548	A -> G	LOC_Os10g01044-LOC_Os10g01060	intergenic_region ; MODIFIER	silent_mutation	Average:95.162; most accessible tissue: Zhenshan97 young leaf, score: 98.014	N	N	N	N
vg1000058548	A -> DEL	N	N	silent_mutation	Average:95.162; most accessible tissue: Zhenshan97 young leaf, score: 98.014	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1000058548	A	G	0.03	0.03	0.01	-0.03	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000058548	2.00E-06	NA	mr1168	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000058548	NA	2.28E-07	mr1168	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000058548	3.51E-07	NA	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000058548	2.65E-06	6.48E-08	mr1383	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000058548	NA	2.47E-13	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000058548	NA	1.65E-06	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000058548	1.83E-06	8.50E-07	mr1158_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000058548	6.95E-06	1.27E-07	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000058548	1.38E-07	NA	mr1168_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000058548	4.66E-06	3.47E-09	mr1168_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000058548	7.62E-07	NA	mr1383_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000058548	NA	1.20E-06	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000058548	NA	4.06E-08	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251