Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922863463:

Variant ID: vg0922863463 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22863463
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

TGATAGGGACCGATGTGTCATAAGCAATATTACTTAGTGAAATTAAAACAGTACCAGCTCCTTGCCAACTCACACAAACTATATACGACCGAAATAATTT[C/T,A]
TAAAGAGTTATAAAAAAATCACGGTTATTTCTAGCACCTAAATATTTCGGTCTCTAAAAGTGATAGCAACACCTACAACTAATAGTCAATATGCAAGACT

Reverse complement sequence

AGTCTTGCATATTGACTATTAGTTGTAGGTGTTGCTATCACTTTTAGAGACCGAAATATTTAGGTGCTAGAAATAACCGTGATTTTTTTATAACTCTTTA[G/A,T]
AAATTATTTCGGTCGTATATAGTTTGTGTGAGTTGGCAAGGAGCTGGTACTGTTTTAATTTCACTAAGTAATATTGCTTATGACACATCGGTCCCTATCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.30%	33.50%	3.41%	16.80%	A: 0.04%
All Indica	2759	12.50%	56.60%	4.60%	26.24%	A: 0.07%
All Japonica	1512	95.00%	0.20%	1.79%	2.98%	NA
Aus	269	94.10%	3.70%	0.74%	1.49%	NA
Indica I	595	31.10%	38.30%	5.71%	24.71%	A: 0.17%
Indica II	465	5.40%	81.30%	2.80%	10.54%	NA
Indica III	913	4.60%	54.10%	5.04%	36.14%	A: 0.11%
Indica Intermediate	786	11.70%	58.80%	4.33%	25.19%	NA
Temperate Japonica	767	99.00%	0.10%	0.52%	0.39%	NA
Tropical Japonica	504	88.30%	0.00%	3.77%	7.94%	NA
Japonica Intermediate	241	96.70%	0.80%	1.66%	0.83%	NA
VI/Aromatic	96	94.80%	0.00%	0.00%	5.21%	NA
Intermediate	90	67.80%	8.90%	5.56%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922863463	C -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922863463	C -> T	LOC_Os09g39890.1	upstream_gene_variant ; 4674.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922863463	C -> T	LOC_Os09g39870.1	downstream_gene_variant ; 4380.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922863463	C -> T	LOC_Os09g39870.2	downstream_gene_variant ; 4381.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922863463	C -> T	LOC_Os09g39880.1	intron_variant ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922863463	C -> A	LOC_Os09g39890.1	upstream_gene_variant ; 4674.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922863463	C -> A	LOC_Os09g39870.1	downstream_gene_variant ; 4380.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922863463	C -> A	LOC_Os09g39870.2	downstream_gene_variant ; 4381.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922863463	C -> A	LOC_Os09g39880.1	intron_variant ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922863463	NA	4.21E-09	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922863463	8.89E-08	NA	mr1865_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922863463	2.34E-06	8.53E-06	mr1865_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251