Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922495561:

Variant ID: vg0922495561 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22495561
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:

ACAATTAAAGTTGGGCACGAAAATTATGGTTGCACTTAAAATGGAACGAAGGGAGCAGCATTAACTATATTTAGTGAGGATGAACTTTATAGATATATAG[A/G]
ATGCCTCGTCGATAGGTTAAATCTACATTCATCTTTGATTTGGATTTTCTTTTTAGTCTAGATAGATACTCACTTCTTCTCATATTGATCATCATATAAG

Reverse complement sequence

CTTATATGATGATCAATATGAGAAGAAGTGAGTATCTATCTAGACTAAAAAGAAAATCCAAATCAAAGATGAATGTAGATTTAACCTATCGACGAGGCAT[T/C]
CTATATATCTATAAAGTTCATCCTCACTAAATATAGTTAATGCTGCTCCCTTCGTTCCATTTTAAGTGCAACCATAATTTTCGTGCCCAACTTTAATTGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.70%	11.40%	1.08%	50.80%	NA
All Indica	2759	3.10%	18.60%	1.09%	77.27%	NA
All Japonica	1512	99.30%	0.10%	0.00%	0.60%	NA
Aus	269	3.00%	7.10%	7.06%	82.90%	NA
Indica I	595	4.50%	31.60%	1.01%	62.86%	NA
Indica II	465	3.20%	8.20%	0.86%	87.74%	NA
Indica III	913	1.20%	15.20%	0.77%	82.80%	NA
Indica Intermediate	786	4.10%	18.70%	1.65%	75.57%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	99.00%	0.00%	0.00%	0.99%	NA
Japonica Intermediate	241	98.30%	0.40%	0.00%	1.24%	NA
VI/Aromatic	96	88.50%	0.00%	2.08%	9.38%	NA
Intermediate	90	62.20%	6.70%	0.00%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922495561	A -> G	LOC_Os09g39170.1	upstream_gene_variant ; 1241.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922495561	A -> G	LOC_Os09g39170-LOC_Os09g39180	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922495561	A -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922495561	NA	6.54E-06	mr1378	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922495561	6.05E-08	NA	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922495561	2.07E-09	3.64E-12	mr1865	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922495561	5.92E-06	NA	mr1520_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922495561	8.83E-06	3.79E-07	mr1520_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922495561	NA	5.83E-08	mr1865_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251