Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922436360:

Variant ID: vg0922436360 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22436360
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACACATCATTTTTAAACTAGACCCATGCATATATAAGTGTCCACTCTCTTTTTTTCATACTTGCACATATATTTATTTGTGCGGATGTGCATATTATAT[C/A,T]
ATTTTATTTATTTAGTTATGAAAGTGTTCTCACTATATATGCGTATGTAAATATAATTTTCAACATCTAGAAAAGTCGTGTTCATGACAGTACGACCTCA

Reverse complement sequence

TGAGGTCGTACTGTCATGAACACGACTTTTCTAGATGTTGAAAATTATATTTACATACGCATATATAGTGAGAACACTTTCATAACTAAATAAATAAAAT[G/T,A]
ATATAATATGCACATCCGCACAAATAAATATATGTGCAAGTATGAAAAAAAGAGAGTGGACACTTATATATGCATGGGTCTAGTTTAAAAATGATGTGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.10%	0.90%	6.52%	19.45%	NA
All Indica	2759	55.80%	1.50%	10.33%	32.37%	NA
All Japonica	1512	99.80%	0.10%	0.07%	0.07%	NA
Aus	269	87.00%	0.70%	6.32%	5.95%	NA
Indica I	595	49.60%	0.80%	17.98%	31.60%	NA
Indica II	465	61.30%	1.50%	13.33%	23.87%	NA
Indica III	913	57.30%	2.30%	2.63%	37.79%	NA
Indica Intermediate	786	55.60%	1.00%	11.70%	31.68%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.00%	0.41%	0.41%	NA
VI/Aromatic	96	95.80%	0.00%	3.12%	1.04%	NA
Intermediate	90	88.90%	0.00%	2.22%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922436360	C -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922436360	C -> T	LOC_Os09g39080.1	upstream_gene_variant ; 2684.0bp to feature; MODIFIER	N	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922436360	C -> T	LOC_Os09g39090.1	downstream_gene_variant ; 1699.0bp to feature; MODIFIER	N	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922436360	C -> T	LOC_Os09g39080-LOC_Os09g39090	intergenic_region ; MODIFIER	N	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922436360	C -> A	LOC_Os09g39080.1	upstream_gene_variant ; 2684.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922436360	C -> A	LOC_Os09g39090.1	downstream_gene_variant ; 1699.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922436360	C -> A	LOC_Os09g39080-LOC_Os09g39090	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922436360	NA	4.82E-29	mr1208	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922436360	NA	5.31E-08	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922436360	NA	4.88E-09	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922436360	1.93E-09	NA	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922436360	3.51E-10	1.70E-09	mr1865	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922436360	NA	8.28E-39	mr1208_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922436360	NA	6.75E-33	mr1598_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922436360	NA	9.93E-16	mr1744_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922436360	2.93E-07	NA	mr1865_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251