Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922383096:

Variant ID: vg0922383096 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22383096
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, C: 0.15, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

CTGTGCTAAAACCCTCATCGCCGCGCCGCCGCCTCCGCCTCTGCTCCGCCGCTCCCAACCCTGCGCGGCGGGCGGCGGTGAGCCGGTCTGCTCTTCCCTC[T/C]
ACCGGCCGCCCACGCTGCTCCTCACGGCGCTCTCGATTCCTGGTTCCTCTCCCCGTGGGCCTCCATGTCTTTGACCACCGTTTCTTTCTCATACCCCGCC

Reverse complement sequence

GGCGGGGTATGAGAAAGAAACGGTGGTCAAAGACATGGAGGCCCACGGGGAGAGGAACCAGGAATCGAGAGCGCCGTGAGGAGCAGCGTGGGCGGCCGGT[A/G]
GAGGGAAGAGCAGACCGGCTCACCGCCGCCCGCCGCGCAGGGTTGGGAGCGGCGGAGCAGAGGCGGAGGCGGCGGCGCGGCGATGAGGGTTTTAGCACAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.00%	41.80%	0.19%	0.00%	NA
All Indica	2759	91.20%	8.50%	0.33%	0.00%	NA
All Japonica	1512	0.60%	99.40%	0.00%	0.00%	NA
Aus	269	68.80%	31.20%	0.00%	0.00%	NA
Indica I	595	97.30%	1.70%	1.01%	0.00%	NA
Indica II	465	83.00%	16.80%	0.22%	0.00%	NA
Indica III	913	93.20%	6.70%	0.11%	0.00%	NA
Indica Intermediate	786	88.90%	10.90%	0.13%	0.00%	NA
Temperate Japonica	767	0.10%	99.90%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	99.00%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	98.80%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	32.20%	67.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922383096	T -> C	LOC_Os09g38980.1	5_prime_UTR_variant ; 65.0bp to feature; MODIFIER	silent_mutation	Average:78.914; most accessible tissue: Zhenshan97 flower, score: 87.906	N	N	N	N
vg0922383096	T -> C	LOC_Os09g38980.2	5_prime_UTR_variant ; 1349.0bp to feature; MODIFIER	silent_mutation	Average:78.914; most accessible tissue: Zhenshan97 flower, score: 87.906	N	N	N	N
vg0922383096	T -> C	LOC_Os09g38990.1	upstream_gene_variant ; 4658.0bp to feature; MODIFIER	silent_mutation	Average:78.914; most accessible tissue: Zhenshan97 flower, score: 87.906	N	N	N	N
vg0922383096	T -> C	LOC_Os09g38970.1	downstream_gene_variant ; 604.0bp to feature; MODIFIER	silent_mutation	Average:78.914; most accessible tissue: Zhenshan97 flower, score: 87.906	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922383096	1.02E-13	5.55E-82	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922383096	4.16E-13	1.45E-11	mr1865	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922383096	NA	8.79E-15	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922383096	4.49E-06	6.45E-37	mr1208_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922383096	NA	7.47E-21	mr1362_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922383096	NA	1.10E-18	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922383096	1.68E-17	1.82E-102	mr1865_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922383096	1.32E-14	2.24E-15	mr1865_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251