Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922373958:

Variant ID: vg0922373958 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22373958
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAGTACAACCCACTACTAGCTTCGAATTATCTATAACTAATCTAATAACCAATTTATACAATACTTATTAATATATGGTCTCATCTGCCATACACACTG[T/C]
GTCTTGAAGTTCGTGCTGCAGCTGGCTACAGATCTATATCCCGCTGCTCTACGCTATCATCTTTTATCTTATTAAAATATGTTTATAGCTAACTAATAGT

Reverse complement sequence

ACTATTAGTTAGCTATAAACATATTTTAATAAGATAAAAGATGATAGCGTAGAGCAGCGGGATATAGATCTGTAGCCAGCTGCAGCACGAACTTCAAGAC[A/G]
CAGTGTGTATGGCAGATGAGACCATATATTAATAAGTATTGTATAAATTGGTTATTAGATTAGTTATAGATAATTCGAAGCTAGTAGTGGGTTGTACTAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.30%	1.10%	9.61%	41.01%	NA
All Indica	2759	19.30%	1.60%	14.28%	64.81%	NA
All Japonica	1512	99.50%	0.00%	0.20%	0.33%	NA
Aus	269	33.80%	2.60%	18.59%	44.98%	NA
Indica I	595	22.20%	0.30%	21.85%	55.63%	NA
Indica II	465	30.10%	1.30%	10.75%	57.85%	NA
Indica III	913	9.70%	2.40%	10.62%	77.22%	NA
Indica Intermediate	786	21.80%	1.90%	14.89%	61.45%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	99.00%	0.00%	0.20%	0.79%	NA
Japonica Intermediate	241	99.20%	0.00%	0.41%	0.41%	NA
VI/Aromatic	96	95.80%	0.00%	1.04%	3.12%	NA
Intermediate	90	70.00%	0.00%	6.67%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922373958	T -> DEL	N	N	silent_mutation	Average:89.414; most accessible tissue: Zhenshan97 flower, score: 96.44	N	N	N	N
vg0922373958	T -> C	LOC_Os09g38960.2	upstream_gene_variant ; 338.0bp to feature; MODIFIER	silent_mutation	Average:89.414; most accessible tissue: Zhenshan97 flower, score: 96.44	N	N	N	N
vg0922373958	T -> C	LOC_Os09g38970.1	upstream_gene_variant ; 2930.0bp to feature; MODIFIER	silent_mutation	Average:89.414; most accessible tissue: Zhenshan97 flower, score: 96.44	N	N	N	N
vg0922373958	T -> C	LOC_Os09g38960.3	upstream_gene_variant ; 338.0bp to feature; MODIFIER	silent_mutation	Average:89.414; most accessible tissue: Zhenshan97 flower, score: 96.44	N	N	N	N
vg0922373958	T -> C	LOC_Os09g38960.4	upstream_gene_variant ; 338.0bp to feature; MODIFIER	silent_mutation	Average:89.414; most accessible tissue: Zhenshan97 flower, score: 96.44	N	N	N	N
vg0922373958	T -> C	LOC_Os09g38960-LOC_Os09g38970	intergenic_region ; MODIFIER	silent_mutation	Average:89.414; most accessible tissue: Zhenshan97 flower, score: 96.44	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0922373958	T	C	0.0	-0.02	-0.02	0.0	-0.01	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922373958	NA	2.33E-06	mr1003	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958	NA	6.43E-06	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958	NA	2.52E-06	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958	NA	6.20E-06	mr1006	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958	NA	4.90E-07	mr1007	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958	NA	1.11E-06	mr1007	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958	NA	1.89E-06	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958	NA	2.79E-06	mr1052	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958	NA	1.49E-09	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958	2.99E-07	NA	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958	4.53E-06	3.27E-06	mr1865	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958	NA	4.68E-06	mr1006_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958	NA	5.06E-07	mr1006_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958	NA	6.63E-06	mr1051_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958	NA	7.16E-07	mr1582_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958	5.15E-06	NA	mr1865_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251