Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922309029:

Variant ID: vg0922309029 (JBrowse)	Variation Type: INDEL
Chromosome: chr09	Position: 22309029
Reference Allele: GGT	Alternative Allele: AGT,G
Primary Allele: GGT	Secondary Allele: AGT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGAGAAGCTTTTTCTTTCCCTCTTACACTAGCATTAACCACGGGATCAATTATTGGCATTGGAGTTGGTAGTGGCGCTGGGATTTTGGTCATGGCTCTC[GGT/AGT,G]
GCAACCTTTTTAACACATAGGATTAAGAATCGGAGAGCAAGAATGCTGAGACAGAAGTTCTTCAAACAGAACCGTGGCCATTTGTTGGAACAGTTGGTAT

Reverse complement sequence

ATACCAACTGTTCCAACAAATGGCCACGGTTCTGTTTGAAGAACTTCTGTCTCAGCATTCTTGCTCTCCGATTCTTAATCCTATGTGTTAAAAAGGTTGC[ACC/ACT,C]
GAGAGCCATGACCAAAATCCCAGCGCCACTACCAACTCCAATGCCAATAATTGATCCCGTGGTTAATGCTAGTGTAAGAGGGAAAGAAAAAGCTTCTCCA

Allele Frequencies:

Populations	Population Size	Frequency of GGT(primary allele)	Frequency of AGT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.90%	0.60%	0.04%	0.49%	NA
All Indica	2759	98.30%	0.90%	0.04%	0.72%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	99.30%	0.00%	0.37%	0.37%	NA
Indica I	595	95.80%	4.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.00%	0.00%	0.22%	NA
Indica III	913	98.00%	0.00%	0.11%	1.86%	NA
Indica Intermediate	786	99.60%	0.10%	0.00%	0.25%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	0.00%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922309029	GGT -> G	LOC_Os09g38834.1	frameshift_variant ; p.Ala389fs; HIGH	N	Average:49.048; most accessible tissue: Callus, score: 65.894	N	N	N	N
vg0922309029	GGT -> G	LOC_Os09g38840.1	upstream_gene_variant ; 2567.0bp to feature; MODIFIER	N	Average:49.048; most accessible tissue: Callus, score: 65.894	N	N	N	N
vg0922309029	GGT -> AGT	LOC_Os09g38834.1	missense_variant ; p.Gly388Ser; MODERATE	N	Average:49.048; most accessible tissue: Callus, score: 65.894	N	N	N	N
vg0922309029	GGT -> AGT	LOC_Os09g38840.1	upstream_gene_variant ; 2568.0bp to feature; MODIFIER	N	Average:49.048; most accessible tissue: Callus, score: 65.894	N	N	N	N
vg0922309029	GGT -> AGT	LOC_Os09g38830.1	downstream_gene_variant ; 3506.0bp to feature; MODIFIER	N	Average:49.048; most accessible tissue: Callus, score: 65.894	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922309029	NA	7.35E-06	mr1921	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922309029	NA	4.93E-06	mr1115_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922309029	NA	6.97E-06	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922309029	NA	1.49E-06	mr1376_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922309029	NA	9.55E-07	mr1431_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922309029	3.32E-06	9.73E-09	mr1570_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922309029	1.85E-06	7.82E-09	mr1571_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922309029	NA	3.51E-06	mr1793_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251