Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922209898:

Variant ID: vg0922209898 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22209898
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCACATAGTGCAGCTAGGTTGCTACTCCACATATGGTGAGTACTTCATCCGTTTCATAATGTAACTCATTCTACCATTTTCCACATCCATATAGATATTA[A/G]
TGAATCTAGATATATATATATGTGTTTAGATTCACTAACTTTCATATGGATGTGGAAAATGCTAAAATAATTTACATTATGAAACGGAGGAAGTATATAA

Reverse complement sequence

TTATATACTTCCTCCGTTTCATAATGTAAATTATTTTAGCATTTTCCACATCCATATGAAAGTTAGTGAATCTAAACACATATATATATATCTAGATTCA[T/C]
TAATATCTATATGGATGTGGAAAATGGTAGAATGAGTTACATTATGAAACGGATGAAGTACTCACCATATGTGGAGTAGCAACCTAGCTGCACTATGTGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.00%	35.40%	1.08%	3.58%	NA
All Indica	2759	35.20%	57.50%	1.49%	5.80%	NA
All Japonica	1512	99.60%	0.30%	0.13%	0.00%	NA
Aus	269	72.10%	23.80%	1.86%	2.23%	NA
Indica I	595	39.30%	57.50%	0.50%	2.69%	NA
Indica II	465	31.40%	55.90%	3.23%	9.46%	NA
Indica III	913	30.40%	61.60%	1.53%	6.46%	NA
Indica Intermediate	786	39.80%	53.80%	1.15%	5.22%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	0.40%	0.83%	0.00%	NA
VI/Aromatic	96	96.90%	2.10%	1.04%	0.00%	NA
Intermediate	90	77.80%	16.70%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922209898	A -> G	LOC_Os09g38610.1	upstream_gene_variant ; 1396.0bp to feature; MODIFIER	silent_mutation	Average:46.428; most accessible tissue: Minghui63 flower, score: 70.849	N	N	N	N
vg0922209898	A -> G	LOC_Os09g38620.1	downstream_gene_variant ; 2492.0bp to feature; MODIFIER	silent_mutation	Average:46.428; most accessible tissue: Minghui63 flower, score: 70.849	N	N	N	N
vg0922209898	A -> G	LOC_Os09g38610-LOC_Os09g38620	intergenic_region ; MODIFIER	silent_mutation	Average:46.428; most accessible tissue: Minghui63 flower, score: 70.849	N	N	N	N
vg0922209898	A -> DEL	N	N	silent_mutation	Average:46.428; most accessible tissue: Minghui63 flower, score: 70.849	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0922209898	A	G	-0.01	-0.02	-0.01	0.0	-0.01	-0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922209898	NA	5.23E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922209898	NA	2.93E-10	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922209898	NA	4.23E-10	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922209898	1.95E-09	NA	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922209898	6.16E-08	9.68E-08	mr1865	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922209898	NA	5.63E-07	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922209898	NA	1.16E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922209898	NA	2.05E-10	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922209898	NA	2.14E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922209898	NA	4.90E-11	mr1559_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922209898	NA	1.89E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922209898	3.12E-10	NA	mr1865_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922209898	1.10E-08	2.32E-08	mr1865_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251