Search for Variation information by Variation ID:
Detailed information for vg0922141239:
| Variant ID: vg0922141239 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 22141239 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.55, A: 0.45, others allele: 0.00, population size: 104. )
Flanking Sequence (100 bp) in Reference Genome:
GATTGACGACAGCACTCGGAACGCCTGCCTCCTGCCCAAGCTGGATGATGGTTGCCCAACAACGGAGACGCTCCAGTTAGCTCATCCAACACTCAGCTTG[G/A]
TGGACGCTCACATTGTTTACATCATGGGTAAGGTTGACGTCTCCGATGAGAAGGCGCTGGTGCTCACCGTTGACATGGCAAACAAGAGGCTACAAGAGGT
Reverse complement sequence
ACCTCTTGTAGCCTCTTGTTTGCCATGTCAACGGTGAGCACCAGCGCCTTCTCATCGGAGACGTCAACCTTACCCATGATGTAAACAATGTGAGCGTCCA[C/T]
CAAGCTGAGTGTTGGATGAGCTAACTGGAGCGTCTCCGTTGTTGGGCAACCATCATCCAGCTTGGGCAGGAGGCAGGCGTTCCGAGTGCTGTCGTCAATC
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.70% | 22.80% | 1.38% | 37.20% | NA |
| All Indica | 2759 | 3.80% | 34.10% | 2.17% | 59.88% | NA |
| All Japonica | 1512 | 99.50% | 0.30% | 0.00% | 0.20% | NA |
| Aus | 269 | 23.00% | 43.90% | 1.49% | 31.60% | NA |
| Indica I | 595 | 2.50% | 41.70% | 2.86% | 52.94% | NA |
| Indica II | 465 | 6.20% | 20.60% | 1.29% | 71.83% | NA |
| Indica III | 913 | 1.50% | 38.00% | 1.75% | 58.71% | NA |
| Indica Intermediate | 786 | 6.00% | 31.90% | 2.67% | 59.41% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 94.80% | 2.10% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 72.20% | 10.00% | 1.11% | 16.67% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922141239 | G -> DEL | LOC_Os09g38470.1 | N | frameshift_variant | Average:14.696; most accessible tissue: Callus, score: 91.253 | N | N | N | N |
| vg0922141239 | G -> A | LOC_Os09g38470.1 | missense_variant ; p.Val381Met; MODERATE | nonsynonymous_codon ; V381M | Average:14.696; most accessible tissue: Callus, score: 91.253 | benign  |
0.276 |
TOLERATED | 0.49 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922141239 | NA | 3.46E-07 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922141239 | NA | 2.48E-11 | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922141239 | 3.07E-08 | 9.57E-75 | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922141239 | 1.42E-06 | NA | mr1865 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922141239 | NA | 1.72E-16 | mr1040_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922141239 | 2.22E-07 | 1.41E-38 | mr1208_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922141239 | NA | 1.98E-23 | mr1362_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922141239 | NA | 4.24E-17 | mr1836_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922141239 | 1.52E-06 | NA | mr1865_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |