Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922081723:

Variant ID: vg0922081723 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22081723
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, A: 0.07, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TACGTGCACTTGAATACTTCATAGTACGTAGTTAAGCTTAAACAAAGCCACAAGCCTAAAATATTTGTTGCATTTGCAGAACATAATGTGCATCCCGTGC[T/A]
TGATGACTTCTTTTCTAGTTTTTTCATGATAAGAGCGTCTACCTAAAAGATTTGAGCATGCTGACTATCGGGTCAGAATTTGATGTTGGTGCCTTGGTGG

Reverse complement sequence

CCACCAAGGCACCAACATCAAATTCTGACCCGATAGTCAGCATGCTCAAATCTTTTAGGTAGACGCTCTTATCATGAAAAAACTAGAAAAGAAGTCATCA[A/T]
GCACGGGATGCACATTATGTTCTGCAAATGCAACAAATATTTTAGGCTTGTGGCTTTGTTTAAGCTTAACTACGTACTATGAAGTATTCAAGTGCACGTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.40% 42.30% 0.28% 0.00% NA
All Indica  2759 90.40% 9.30% 0.33% 0.00% NA
All Japonica  1512 0.40% 99.60% 0.00% 0.00% NA
Aus  269 69.10% 30.90% 0.00% 0.00% NA
Indica I  595 97.10% 2.50% 0.34% 0.00% NA
Indica II  465 87.50% 12.00% 0.43% 0.00% NA
Indica III  913 89.70% 10.20% 0.11% 0.00% NA
Indica Intermediate  786 87.70% 11.80% 0.51% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 25.60% 70.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922081723 T -> A LOC_Os09g38350.1 downstream_gene_variant ; 914.0bp to feature; MODIFIER silent_mutation Average:57.065; most accessible tissue: Zhenshan97 root, score: 91.476 N N N N
vg0922081723 T -> A LOC_Os09g38340-LOC_Os09g38350 intergenic_region ; MODIFIER silent_mutation Average:57.065; most accessible tissue: Zhenshan97 root, score: 91.476 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0922081723 T A 0.01 0.01 0.01 0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922081723 NA 4.29E-08 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922081723 NA 1.35E-07 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922081723 NA 2.46E-13 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922081723 NA 5.86E-11 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922081723 NA 2.24E-08 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922081723 2.91E-09 3.91E-74 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922081723 3.13E-06 8.07E-06 mr1865 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922081723 NA 1.54E-15 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922081723 NA 5.91E-16 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922081723 NA 4.90E-12 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922081723 NA 1.84E-37 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922081723 NA 1.62E-21 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922081723 NA 6.96E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922081723 NA 1.52E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922081723 NA 1.09E-19 mr1581_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922081723 NA 1.66E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922081723 5.52E-06 4.44E-21 mr1836_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922081723 4.72E-06 NA mr1865_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251