| Variant ID: vg0921537073 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 21537073 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 80. )
ATAAACTTCGATGAGAAAATCTCAAGATCAGCTTTAAATTTAAGGTTAAAAATTCAAAATTTGGCTGATAAAACATAAACATAAGCGAAAAGATGGGGCT[G/A]
GAACATGTAGGTTTTGCCTGCATTGACGAAACCTGTCGTGTCGAGTGAAGTCGTGTCACCGGTAGATCACGAATGGGCAGCGAGATTTCGGAGCATCTTT
AAAGATGCTCCGAAATCTCGCTGCCCATTCGTGATCTACCGGTGACACGACTTCACTCGACACGACAGGTTTCGTCAATGCAGGCAAAACCTACATGTTC[C/T]
AGCCCCATCTTTTCGCTTATGTTTATGTTTTATCAGCCAAATTTTGAATTTTTAACCTTAAATTTAAAGCTGATCTTGAGATTTTCTCATCGAAGTTTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.00% | 40.70% | 0.34% | 0.00% | NA |
| All Indica | 2759 | 35.00% | 64.80% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 96.30% | 3.10% | 0.60% | 0.00% | NA |
| Aus | 269 | 76.60% | 22.70% | 0.74% | 0.00% | NA |
| Indica I | 595 | 15.50% | 84.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 38.10% | 61.30% | 0.65% | 0.00% | NA |
| Indica III | 913 | 41.80% | 58.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 40.20% | 59.50% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 98.60% | 1.00% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.20% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 84.60% | 13.70% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0921537073 | G -> A | LOC_Os09g37280.1 | downstream_gene_variant ; 915.0bp to feature; MODIFIER | silent_mutation | Average:48.517; most accessible tissue: Callus, score: 74.153 | N | N | N | N |
| vg0921537073 | G -> A | LOC_Os09g37280.2 | downstream_gene_variant ; 807.0bp to feature; MODIFIER | silent_mutation | Average:48.517; most accessible tissue: Callus, score: 74.153 | N | N | N | N |
| vg0921537073 | G -> A | LOC_Os09g37270-LOC_Os09g37280 | intergenic_region ; MODIFIER | silent_mutation | Average:48.517; most accessible tissue: Callus, score: 74.153 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0921537073 | 1.26E-06 | 1.58E-24 | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921537073 | 2.99E-07 | 7.96E-08 | mr1003 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921537073 | NA | 3.85E-07 | mr1004 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921537073 | NA | 1.37E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921537073 | 8.37E-06 | 1.99E-10 | mr1006 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921537073 | NA | 3.97E-10 | mr1007 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921537073 | 2.76E-06 | 3.75E-25 | mr1051 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921537073 | 9.31E-07 | 3.80E-08 | mr1051 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921537073 | NA | 6.65E-07 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921537073 | 7.43E-06 | 6.92E-11 | mr1052 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/