RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0921459327:

Variant ID: vg0921459327 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 21459327
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.78, C: 0.22, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

GTAAAACAAAAACAAATTGGGCGTTGATTTTTAGTTAATCCAAATGAATATAGAGATGCGCAATTAACTACTCCCTCCATTCCAAATTGATCTACATATT[C/T]
CATAAGTACACTAAAACCAAGAAAAGTTAATAATTTTCTCATGTTATATTTACTCTAGCAACAAACTCAATGCATGCACCATCCCCAATATTTCCTAGCC

Reverse complement sequence

GGCTAGGAAATATTGGGGATGGTGCATGCATTGAGTTTGTTGCTAGAGTAAATATAACATGAGAAAATTATTAACTTTTCTTGGTTTTAGTGTACTTATG[G/A]
AATATGTAGATCAATTTGGAATGGAGGGAGTAGTTAATTGCGCATCTCTATATTCATTTGGATTAACTAAAAATCAACGCCCAATTTGTTTTTGTTTTAC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.10%	21.60%	0.11%	0.19%	NA
All Indica	2759	63.80%	35.70%	0.18%	0.29%	NA
All Japonica	1512	99.80%	0.10%	0.00%	0.07%	NA
Aus	269	91.10%	8.90%	0.00%	0.00%	NA
Indica I	595	72.30%	27.40%	0.34%	0.00%	NA
Indica II	465	65.60%	33.30%	0.22%	0.86%	NA
Indica III	913	57.10%	42.60%	0.00%	0.33%	NA
Indica Intermediate	786	64.10%	35.50%	0.25%	0.13%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0921459327	C -> DEL	N	N	silent_mutation	Average:50.124; most accessible tissue: Zhenshan97 root, score: 86.991	N	N	N	N
vg0921459327	C -> T	LOC_Os09g37200.1	upstream_gene_variant ; 4292.0bp to feature; MODIFIER	silent_mutation	Average:50.124; most accessible tissue: Zhenshan97 root, score: 86.991	N	N	N	N
vg0921459327	C -> T	LOC_Os09g37180-LOC_Os09g37200	intergenic_region ; MODIFIER	silent_mutation	Average:50.124; most accessible tissue: Zhenshan97 root, score: 86.991	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0921459327	3.36E-07	NA	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	3.40E-06	7.24E-09	mr1003	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	8.34E-06	6.41E-09	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	NA	6.87E-08	mr1004	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	5.13E-11	1.53E-15	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	4.79E-09	6.19E-16	mr1006	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	7.92E-10	8.51E-15	mr1007	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	1.48E-08	3.85E-15	mr1007	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	NA	9.60E-07	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	1.78E-07	NA	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 28 entries

Previous1 2 3Next

Search for Variation information by Variation ID:

Detailed information for vg0921459327:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact