Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920758578:

Variant ID: vg0920758578 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20758578
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACAAAATGGGTCAATACAATTTCCATGCACAGTGCGACGGTCAGTTCAGTACTCGGCTTCCCTCTCTGTAACGTGTGTTTGGGCGGTTGTCACATGGTT[C/T]
GGGGTGTGTGCTCTGGTGCACTTCCTTTATCGACAGCCAGCTGCCGATGTAAAACTTTTCAGGTAACCTTTTTTTCTTCAATCTTAATCACATTGATTGA

Reverse complement sequence

TCAATCAATGTGATTAAGATTGAAGAAAAAAAGGTTACCTGAAAAGTTTTACATCGGCAGCTGGCTGTCGATAAAGGAAGTGCACCAGAGCACACACCCC[G/A]
AACCATGTGACAACCGCCCAAACACACGTTACAGAGAGGGAAGCCGAGTACTGAACTGACCGTCGCACTGTGCATGGAAATTGTATTGACCCATTTTGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.20% 21.70% 0.06% 0.00% NA
All Indica  2759 63.40% 36.50% 0.07% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 96.30% 3.30% 0.37% 0.00% NA
Indica I  595 95.80% 4.20% 0.00% 0.00% NA
Indica II  465 84.30% 15.70% 0.00% 0.00% NA
Indica III  913 28.50% 71.40% 0.11% 0.00% NA
Indica Intermediate  786 67.00% 32.80% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920758578 C -> T LOC_Os09g36040.1 downstream_gene_variant ; 3929.0bp to feature; MODIFIER silent_mutation Average:97.377; most accessible tissue: Minghui63 young leaf, score: 98.537 N N N N
vg0920758578 C -> T LOC_Os09g36050.1 downstream_gene_variant ; 1198.0bp to feature; MODIFIER silent_mutation Average:97.377; most accessible tissue: Minghui63 young leaf, score: 98.537 N N N N
vg0920758578 C -> T LOC_Os09g36050-LOC_Os09g36060 intergenic_region ; MODIFIER silent_mutation Average:97.377; most accessible tissue: Minghui63 young leaf, score: 98.537 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0920758578 C T 0.0 0.0 -0.01 0.0 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920758578 NA 9.66E-10 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0920758578 NA 6.34E-09 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920758578 NA 4.20E-09 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920758578 NA 1.65E-09 mr1870 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920758578 NA 8.64E-08 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920758578 NA 5.88E-06 mr1159_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920758578 NA 1.38E-07 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920758578 NA 2.11E-10 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920758578 NA 1.39E-07 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920758578 NA 2.73E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920758578 NA 6.96E-07 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920758578 NA 5.12E-06 mr1511_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920758578 NA 2.48E-06 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920758578 NA 5.19E-08 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920758578 NA 1.29E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920758578 NA 4.05E-08 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920758578 NA 8.00E-06 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920758578 NA 9.34E-08 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920758578 NA 6.54E-10 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920758578 NA 4.58E-06 mr1954_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920758578 NA 4.30E-06 mr1954_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251