| Variant ID: vg0920611687 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 20611687 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 222. )
TCGATGTTTCAACCAGTAGCTTTACGATGTTTCACTATGTACGGATCAAATGTTGCAGTGGATTTTGATATTATGGAACGTGCCGTTGTGACAAATCACC[C/T]
ACATATTTTGAAAACCCCCTATTAAGGGAATTTGGTTTATTTTTTGTTCCACAAAAAATGTTTCATCTAGTGTACTCACAATATTTCACTATGTATAGAT
ATCTATACATAGTGAAATATTGTGAGTACACTAGATGAAACATTTTTTGTGGAACAAAAAATAAACCAAATTCCCTTAATAGGGGGTTTTCAAAATATGT[G/A]
GGTGATTTGTCACAACGGCACGTTCCATAATATCAAAATCCACTGCAACATTTGATCCGTACATAGTGAAACATCGTAAAGCTACTGGTTGAAACATCGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.40% | 5.20% | 0.40% | 0.00% | NA |
| All Indica | 2759 | 90.50% | 8.90% | 0.62% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.60% | 9.10% | 1.34% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 88.90% | 10.70% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 87.70% | 11.60% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0920611687 | C -> T | LOC_Os09g35810.1 | upstream_gene_variant ; 2317.0bp to feature; MODIFIER | silent_mutation | Average:42.756; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0920611687 | C -> T | LOC_Os09g35830.3 | upstream_gene_variant ; 1701.0bp to feature; MODIFIER | silent_mutation | Average:42.756; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0920611687 | C -> T | LOC_Os09g35810.2 | upstream_gene_variant ; 2317.0bp to feature; MODIFIER | silent_mutation | Average:42.756; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0920611687 | C -> T | LOC_Os09g35830.1 | upstream_gene_variant ; 1701.0bp to feature; MODIFIER | silent_mutation | Average:42.756; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0920611687 | C -> T | LOC_Os09g35830.2 | upstream_gene_variant ; 1701.0bp to feature; MODIFIER | silent_mutation | Average:42.756; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0920611687 | C -> T | LOC_Os09g35830.4 | upstream_gene_variant ; 1701.0bp to feature; MODIFIER | silent_mutation | Average:42.756; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0920611687 | C -> T | LOC_Os09g35820.1 | downstream_gene_variant ; 1081.0bp to feature; MODIFIER | silent_mutation | Average:42.756; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0920611687 | C -> T | LOC_Os09g35820-LOC_Os09g35830 | intergenic_region ; MODIFIER | silent_mutation | Average:42.756; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0920611687 | NA | 2.94E-06 | mr1627 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920611687 | NA | 8.84E-19 | mr1739 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920611687 | NA | 2.38E-13 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920611687 | NA | 7.56E-06 | mr1839 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920611687 | NA | 5.46E-07 | mr1128_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920611687 | NA | 4.97E-17 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920611687 | NA | 8.81E-13 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920611687 | NA | 3.29E-07 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |