Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920162123:

Variant ID: vg0920162123 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 20162123
Reference Allele: T	Alternative Allele: C,G
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:

TAGCAAACGTCTTATAAGATAAGGTCATCCTCAATGTTTGTTGCAAAAGTAGATAATAAGGTGAGTCCATGTAAGATGACAATAGTAGATTGAAGATGTA[T/C,G]
CATAATGTATATATATATAGAGTGGGTAATAAGGTAAAACCCATCTAAAAAAACCTCAAATATAAACTATGCCACAATTAAAAAATAGTTAGAACCCACC

Reverse complement sequence

GGTGGGTTCTAACTATTTTTTAATTGTGGCATAGTTTATATTTGAGGTTTTTTTAGATGGGTTTTACCTTATTACCCACTCTATATATATATACATTATG[A/G,C]
TACATCTTCAATCTACTATTGTCATCTTACATGGACTCACCTTATTATCTACTTTTGCAACAAACATTGAGGATGACCTTATCTTATAAGACGTTTGCTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.60%	32.40%	0.59%	0.70%	G: 12.72%
All Indica	2759	85.50%	3.50%	0.87%	0.69%	G: 9.46%
All Japonica	1512	9.40%	88.80%	0.07%	0.00%	G: 1.72%
Aus	269	1.10%	0.40%	0.37%	5.20%	G: 92.94%
Indica I	595	86.20%	4.20%	1.34%	0.17%	G: 8.07%
Indica II	465	90.30%	5.60%	0.43%	0.43%	G: 3.23%
Indica III	913	87.50%	0.70%	0.66%	0.88%	G: 10.30%
Indica Intermediate	786	79.80%	5.00%	1.02%	1.02%	G: 13.23%
Temperate Japonica	767	11.10%	88.90%	0.00%	0.00%	NA
Tropical Japonica	504	1.40%	96.40%	0.00%	0.00%	G: 2.18%
Japonica Intermediate	241	20.70%	72.60%	0.41%	0.00%	G: 6.22%
VI/Aromatic	96	8.30%	41.70%	1.04%	0.00%	G: 48.96%
Intermediate	90	24.40%	55.60%	1.11%	0.00%	G: 18.89%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0920162123	T -> G	LOC_Os09g34150.1	upstream_gene_variant ; 115.0bp to feature; MODIFIER	silent_mutation	Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192	N	N	N	N
vg0920162123	T -> G	LOC_Os09g34150.2	upstream_gene_variant ; 115.0bp to feature; MODIFIER	silent_mutation	Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192	N	N	N	N
vg0920162123	T -> G	LOC_Os09g34140.1	downstream_gene_variant ; 4799.0bp to feature; MODIFIER	silent_mutation	Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192	N	N	N	N
vg0920162123	T -> G	LOC_Os09g34160.1	downstream_gene_variant ; 547.0bp to feature; MODIFIER	silent_mutation	Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192	N	N	N	N
vg0920162123	T -> G	LOC_Os09g34140.2	downstream_gene_variant ; 3867.0bp to feature; MODIFIER	silent_mutation	Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192	N	N	N	N
vg0920162123	T -> G	LOC_Os09g34150-LOC_Os09g34160	intergenic_region ; MODIFIER	silent_mutation	Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192	N	N	N	N
vg0920162123	T -> DEL	N	N	silent_mutation	Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192	N	N	N	N
vg0920162123	T -> C	LOC_Os09g34150.1	upstream_gene_variant ; 115.0bp to feature; MODIFIER	silent_mutation	Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192	N	N	N	N
vg0920162123	T -> C	LOC_Os09g34150.2	upstream_gene_variant ; 115.0bp to feature; MODIFIER	silent_mutation	Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192	N	N	N	N
vg0920162123	T -> C	LOC_Os09g34140.1	downstream_gene_variant ; 4799.0bp to feature; MODIFIER	silent_mutation	Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192	N	N	N	N
vg0920162123	T -> C	LOC_Os09g34160.1	downstream_gene_variant ; 547.0bp to feature; MODIFIER	silent_mutation	Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192	N	N	N	N
vg0920162123	T -> C	LOC_Os09g34140.2	downstream_gene_variant ; 3867.0bp to feature; MODIFIER	silent_mutation	Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192	N	N	N	N
vg0920162123	T -> C	LOC_Os09g34150-LOC_Os09g34160	intergenic_region ; MODIFIER	silent_mutation	Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0920162123	T	C	0.01	0.02	0.02	0.02	0.02	0.01
vg0920162123	T	G	0.03	0.02	0.03	0.03	0.04	0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0920162123	NA	2.03E-14	mr1059	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	7.33E-16	mr1167	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	3.90E-08	mr1216	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	3.81E-10	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	7.11E-20	mr1324	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	2.22E-12	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	1.22E-14	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	7.33E-30	mr1333	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	6.84E-16	mr1335	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	3.82E-09	mr1410	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	1.91E-07	3.23E-28	mr1518	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	1.70E-11	5.71E-15	mr1518	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	8.88E-07	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	1.19E-14	mr1535	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	2.90E-08	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	7.17E-15	mr1675	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	7.90E-07	1.29E-31	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	4.27E-13	9.03E-18	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	8.07E-08	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	8.03E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	2.06E-20	mr1817	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	3.06E-28	mr1922	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	4.91E-12	mr1940	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	3.03E-15	mr1950	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	1.32E-14	mr1969	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	8.29E-09	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	7.87E-06	mr1064_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	1.95E-20	mr1167_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	1.37E-06	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	7.52E-06	mr1565_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	2.02E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	3.34E-10	2.02E-33	mr1676_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	1.26E-20	2.03E-24	mr1676_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	2.59E-15	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	1.37E-18	mr1817_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	1.57E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123	NA	5.09E-15	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251