| Variant ID: vg0919939971 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 19939971 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTTGATCAAAACGGCAGACAAAGCGAGAGAGCTCAAAGGATGACGACTTGACGAGCCGGCCGGGTACAGAAAAGTTACCGGCTCCGGGTTGCTTGCTCGC[C/T]
GTCGACGCCAGCGTCCGCGAGGACCGCGAACTGGCGGACGCGGCGCGCAAGGCGCTTGGCGTGGCGCTCGCGCTCGGGGGCGCCGCCGCGCACGTCATGC
GCATGACGTGCGCGGCGGCGCCCCCGAGCGCGAGCGCCACGCCAAGCGCCTTGCGCGCCGCGTCCGCCAGTTCGCGGTCCTCGCGGACGCTGGCGTCGAC[G/A]
GCGAGCAAGCAACCCGGAGCCGGTAACTTTTCTGTACCCGGCCGGCTCGTCAAGTCGTCATCCTTTGAGCTCTCTCGCTTTGTCTGCCGTTTTGATCAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.90% | 3.60% | 2.94% | 0.55% | NA |
| All Indica | 2759 | 89.00% | 6.00% | 4.82% | 0.14% | NA |
| All Japonica | 1512 | 99.80% | 0.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 91.10% | 0.00% | 1.49% | 7.43% | NA |
| Indica I | 595 | 75.00% | 12.10% | 12.94% | 0.00% | NA |
| Indica II | 465 | 88.00% | 7.10% | 4.95% | 0.00% | NA |
| Indica III | 913 | 98.20% | 1.40% | 0.22% | 0.11% | NA |
| Indica Intermediate | 786 | 89.60% | 6.10% | 3.94% | 0.38% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 95.60% | 2.20% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0919939971 | C -> DEL | N | N | silent_mutation | Average:66.57; most accessible tissue: Zhenshan97 young leaf, score: 79.783 | N | N | N | N |
| vg0919939971 | C -> T | LOC_Os09g33770.1 | upstream_gene_variant ; 566.0bp to feature; MODIFIER | silent_mutation | Average:66.57; most accessible tissue: Zhenshan97 young leaf, score: 79.783 | N | N | N | N |
| vg0919939971 | C -> T | LOC_Os09g33780.1 | upstream_gene_variant ; 3553.0bp to feature; MODIFIER | silent_mutation | Average:66.57; most accessible tissue: Zhenshan97 young leaf, score: 79.783 | N | N | N | N |
| vg0919939971 | C -> T | LOC_Os09g33750.1 | downstream_gene_variant ; 2290.0bp to feature; MODIFIER | silent_mutation | Average:66.57; most accessible tissue: Zhenshan97 young leaf, score: 79.783 | N | N | N | N |
| vg0919939971 | C -> T | LOC_Os09g33760.1 | downstream_gene_variant ; 545.0bp to feature; MODIFIER | silent_mutation | Average:66.57; most accessible tissue: Zhenshan97 young leaf, score: 79.783 | N | N | N | N |
| vg0919939971 | C -> T | LOC_Os09g33760-LOC_Os09g33770 | intergenic_region ; MODIFIER | silent_mutation | Average:66.57; most accessible tissue: Zhenshan97 young leaf, score: 79.783 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0919939971 | 9.53E-06 | 7.88E-06 | mr1418 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919939971 | 1.45E-08 | 1.45E-08 | mr1823 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919939971 | NA | 3.46E-06 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |