Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919906368:

Variant ID: vg0919906368 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 19906368
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

ACCTAGATTTTAAGAATATGTAGCTATAAAATACAGAAAATGACCATCTAGTTGTTTATCAAAATCTTAAAAATTTCTCTAGTAGAGCCTCAGCTTCTCA[G/A]
AATCAAGTCGTAAAAAAATAAATAATAATTATGTAGATTTCTCCGGAGTCACAATGTGATGTCGGATTTCTTCGGCCGGAGCTTTGCCGCCGAGGAGGAA

Reverse complement sequence

TTCCTCCTCGGCGGCAAAGCTCCGGCCGAAGAAATCCGACATCACATTGTGACTCCGGAGAAATCTACATAATTATTATTTATTTTTTTACGACTTGATT[C/T]
TGAGAAGCTGAGGCTCTACTAGAGAAATTTTTAAGATTTTGATAAACAACTAGATGGTCATTTTCTGTATTTTATAGCTACATATTCTTAAAATCTAGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.70%	15.00%	1.38%	0.00%	NA
All Indica	2759	89.10%	10.90%	0.07%	0.00%	NA
All Japonica	1512	85.60%	10.30%	4.10%	0.00%	NA
Aus	269	19.30%	80.70%	0.00%	0.00%	NA
Indica I	595	89.60%	10.40%	0.00%	0.00%	NA
Indica II	465	91.60%	8.20%	0.22%	0.00%	NA
Indica III	913	90.30%	9.70%	0.00%	0.00%	NA
Indica Intermediate	786	85.80%	14.10%	0.13%	0.00%	NA
Temperate Japonica	767	95.60%	0.00%	4.43%	0.00%	NA
Tropical Japonica	504	69.20%	27.20%	3.57%	0.00%	NA
Japonica Intermediate	241	88.40%	7.50%	4.15%	0.00%	NA
VI/Aromatic	96	78.10%	21.90%	0.00%	0.00%	NA
Intermediate	90	83.30%	15.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0919906368	G -> A	LOC_Os09g33690.1	upstream_gene_variant ; 1816.0bp to feature; MODIFIER	silent_mutation	Average:64.284; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0919906368	G -> A	LOC_Os09g33690.3	upstream_gene_variant ; 1894.0bp to feature; MODIFIER	silent_mutation	Average:64.284; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0919906368	G -> A	LOC_Os09g33690.2	upstream_gene_variant ; 1816.0bp to feature; MODIFIER	silent_mutation	Average:64.284; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0919906368	G -> A	LOC_Os09g33690.4	upstream_gene_variant ; 1816.0bp to feature; MODIFIER	silent_mutation	Average:64.284; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0919906368	G -> A	LOC_Os09g33700.1	downstream_gene_variant ; 1433.0bp to feature; MODIFIER	silent_mutation	Average:64.284; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0919906368	G -> A	LOC_Os09g33710.1	downstream_gene_variant ; 2274.0bp to feature; MODIFIER	silent_mutation	Average:64.284; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0919906368	G -> A	LOC_Os09g33690-LOC_Os09g33700	intergenic_region ; MODIFIER	silent_mutation	Average:64.284; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0919906368	6.00E-07	1.47E-13	mr1216	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919906368	8.28E-10	2.84E-16	mr1216	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919906368	NA	5.90E-06	mr1937	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919906368	NA	2.04E-07	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919906368	4.16E-07	NA	mr1793_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919906368	2.28E-11	2.31E-14	mr1793_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251