Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919514800:

Variant ID: vg0919514800 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 19514800
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, T: 0.08, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

ATTAGCTATAGAATAGGATTATATAAGTAGGAGGGAGGGATGATTAGAGGAAGGAAGAAACATATACGTACTATGTATATATGTACTTGCAATGTGGGCT[A/T]
GTGGGTGGGAGAGAGTATATGCACGTAACGTACGTACAGGTGTGACCATATGTACTTCTAATTTCTAATGTCTAGGTTGTTGTAAGATTAATTTAATCTA

Reverse complement sequence

TAGATTAAATTAATCTTACAACAACCTAGACATTAGAAATTAGAAGTACATATGGTCACACCTGTACGTACGTTACGTGCATATACTCTCTCCCACCCAC[T/A]
AGCCCACATTGCAAGTACATATATACATAGTACGTATATGTTTCTTCCTTCCTCTAATCATCCCTCCCTCCTACTTATATAATCCTATTCTATAGCTAAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.70%	36.90%	12.95%	0.36%	NA
All Indica	2759	23.60%	56.60%	19.21%	0.62%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	19.30%	54.30%	26.39%	0.00%	NA
Indica I	595	27.20%	54.30%	18.32%	0.17%	NA
Indica II	465	24.70%	51.40%	22.15%	1.72%	NA
Indica III	913	20.20%	62.50%	16.87%	0.44%	NA
Indica Intermediate	786	24.00%	54.60%	20.87%	0.51%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	79.20%	12.50%	8.33%	0.00%	NA
Intermediate	90	72.20%	24.40%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0919514800	A -> DEL	N	N	silent_mutation	Average:40.778; most accessible tissue: Zhenshan97 root, score: 70.636	N	N	N	N
vg0919514800	A -> T	LOC_Os09g32710.1	upstream_gene_variant ; 2126.0bp to feature; MODIFIER	silent_mutation	Average:40.778; most accessible tissue: Zhenshan97 root, score: 70.636	N	N	N	N
vg0919514800	A -> T	LOC_Os09g32730.1	downstream_gene_variant ; 4440.0bp to feature; MODIFIER	silent_mutation	Average:40.778; most accessible tissue: Zhenshan97 root, score: 70.636	N	N	N	N
vg0919514800	A -> T	LOC_Os09g32710-LOC_Os09g32730	intergenic_region ; MODIFIER	silent_mutation	Average:40.778; most accessible tissue: Zhenshan97 root, score: 70.636	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0919514800	NA	6.09E-06	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919514800	NA	9.16E-06	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919514800	7.79E-06	1.48E-07	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919514800	NA	1.39E-06	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919514800	NA	4.14E-24	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919514800	1.61E-06	4.23E-07	mr1548	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919514800	NA	4.05E-21	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919514800	NA	3.41E-08	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919514800	NA	8.79E-07	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919514800	NA	6.56E-21	mr1676_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919514800	NA	8.73E-06	mr1676_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251