Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918823110:

Variant ID: vg0918823110 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18823110
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


CTCTACTAGAGAGCTACAAGCACTAGGCTACATACCTGTTCACCATTTTCATTGTTAAAGAAAGCTCAACATTGTGTTGCATTTGTTTTTGGACGCACGC[G/A]
CACACACACACAGGAGTTTGTAAGTGGCCAACCCGTAAAATTCACTTATAAAACAAAACAAGCCATGAACCTGCTTATTTTGATCTATAAGTGGGTTCAC

Reverse complement sequence

GTGAACCCACTTATAGATCAAAATAAGCAGGTTCATGGCTTGTTTTGTTTTATAAGTGAATTTTACGGGTTGGCCACTTACAAACTCCTGTGTGTGTGTG[C/T]
GCGTGCGTCCAAAAACAAATGCAACACAATGTTGAGCTTTCTTTAACAATGAAAATGGTGAACAGGTATGTAGCCTAGTGCTTGTAGCTCTCTAGTAGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.10% 26.60% 0.08% 0.30% NA
All Indica  2759 97.90% 1.70% 0.11% 0.22% NA
All Japonica  1512 23.40% 76.50% 0.00% 0.13% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.80% 2.00% 0.00% 0.17% NA
Indica II  465 97.00% 2.80% 0.00% 0.22% NA
Indica III  913 99.70% 0.10% 0.00% 0.22% NA
Indica Intermediate  786 96.60% 2.80% 0.38% 0.25% NA
Temperate Japonica  767 29.90% 70.10% 0.00% 0.00% NA
Tropical Japonica  504 11.90% 87.90% 0.00% 0.20% NA
Japonica Intermediate  241 27.00% 72.60% 0.00% 0.41% NA
VI/Aromatic  96 83.30% 16.70% 0.00% 0.00% NA
Intermediate  90 53.30% 38.90% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918823110 G -> DEL N N silent_mutation Average:80.821; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg0918823110 G -> A LOC_Os09g31310.1 downstream_gene_variant ; 2405.0bp to feature; MODIFIER silent_mutation Average:80.821; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg0918823110 G -> A LOC_Os09g31300-LOC_Os09g31310 intergenic_region ; MODIFIER silent_mutation Average:80.821; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0918823110 G A -0.02 -0.03 -0.03 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918823110 NA 2.25E-15 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918823110 NA 4.71E-23 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918823110 NA 3.22E-25 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918823110 1.62E-07 NA mr1719 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918823110 NA 2.69E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918823110 NA 2.26E-24 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251