Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918671171:

Variant ID: vg0918671171 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 18671171
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 345. )

Flanking Sequence (100 bp) in Reference Genome:

GTCATACTCCTGTACTTTGTATTGGAAATTTGAAATCGTCATTGGTTGCCTCCGTGTGCGCTTGTCACGGATTTGGAAATTTGGATAGAGTCGCATCAGT[C/T]
TGAACACCAATTCAGTTCAGTGGTTTGCCTTTGAATTGTGTTTATTCTAGTGATTACTGTGTTCTGCATCGGTTGCAATACACGCTGTACAGTTTTTTTC

Reverse complement sequence

GAAAAAAACTGTACAGCGTGTATTGCAACCGATGCAGAACACAGTAATCACTAGAATAAACACAATTCAAAGGCAAACCACTGAACTGAATTGGTGTTCA[G/A]
ACTGATGCGACTCTATCCAAATTTCCAAATCCGTGACAAGCGCACACGGAGGCAACCAATGACGATTTCAAATTTCCAATACAAAGTACAGGAGTATGAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.00%	30.00%	0.02%	0.00%	NA
All Indica	2759	98.30%	1.70%	0.00%	0.00%	NA
All Japonica	1512	13.60%	86.40%	0.00%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	98.20%	1.80%	0.00%	0.00%	NA
Indica II	465	96.30%	3.70%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	97.80%	2.20%	0.00%	0.00%	NA
Temperate Japonica	767	10.70%	89.30%	0.00%	0.00%	NA
Tropical Japonica	504	21.00%	79.00%	0.00%	0.00%	NA
Japonica Intermediate	241	7.50%	92.50%	0.00%	0.00%	NA
VI/Aromatic	96	78.10%	21.90%	0.00%	0.00%	NA
Intermediate	90	50.00%	50.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0918671171	C -> T	LOC_Os09g31031.3	splice_region_variant ; LOW	silent_mutation	Average:63.666; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0918671171	C -> T	LOC_Os09g31031.3	3_prime_UTR_variant ; 171.0bp to feature; MODIFIER	silent_mutation	Average:63.666; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0918671171	C -> T	LOC_Os09g31040.1	upstream_gene_variant ; 966.0bp to feature; MODIFIER	silent_mutation	Average:63.666; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0918671171	C -> T	LOC_Os09g31060.1	upstream_gene_variant ; 4008.0bp to feature; MODIFIER	silent_mutation	Average:63.666; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0918671171	C -> T	LOC_Os09g31025.1	downstream_gene_variant ; 2919.0bp to feature; MODIFIER	silent_mutation	Average:63.666; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0918671171	C -> T	LOC_Os09g31050.1	downstream_gene_variant ; 2159.0bp to feature; MODIFIER	silent_mutation	Average:63.666; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0918671171	C -> T	LOC_Os09g31031.1	intron_variant ; MODIFIER	silent_mutation	Average:63.666; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0918671171	C -> T	LOC_Os09g31031.2	intron_variant ; MODIFIER	silent_mutation	Average:63.666; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0918671171	NA	2.21E-10	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0918671171	2.00E-06	NA	mr1125	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918671171	NA	5.49E-15	mr1276	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918671171	NA	7.88E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918671171	NA	1.78E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918671171	NA	3.33E-22	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918671171	NA	2.74E-24	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251