Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918268132:

Variant ID: vg0918268132 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 18268132
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTACTTTTACAGCCTTTCCAAGCAAACCCTAGGAACCGAATATGGGGAGATATCTTCTTGGAAGACAGGAGGATTGACCGCCCCCCGGACGACCCTCCTC[C/T]
TGTTTTATATGATAGAACCTCCGAGTCCGGATCTTTGACGAACTTCCACCATGGGTACCAACCAAAACCATATCTTCTTTGTATTCCATATCCAATTACT

Reverse complement sequence

AGTAATTGGATATGGAATACAAAGAAGATATGGTTTTGGTTGGTACCCATGGTGGAAGTTCGTCAAAGATCCGGACTCGGAGGTTCTATCATATAAAACA[G/A]
GAGGAGGGTCGTCCGGGGGGCGGTCAATCCTCCTGTCTTCCAAGAAGATATCTCCCCATATTCGGTTCCTAGGGTTTGCTTGGAAAGGCTGTAAAAGTAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.50%	6.80%	0.70%	0.00%	NA
All Indica	2759	99.10%	0.10%	0.76%	0.00%	NA
All Japonica	1512	79.60%	19.60%	0.73%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.10%	0.40%	1.51%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.00%	0.30%	1.78%	0.00%	NA
Temperate Japonica	767	99.50%	0.10%	0.39%	0.00%	NA
Tropical Japonica	504	45.60%	53.80%	0.60%	0.00%	NA
Japonica Intermediate	241	87.60%	10.40%	2.07%	0.00%	NA
VI/Aromatic	96	89.60%	9.40%	1.04%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0918268132	C -> T	LOC_Os09g30020.1	upstream_gene_variant ; 237.0bp to feature; MODIFIER	silent_mutation	Average:48.175; most accessible tissue: Zhenshan97 young leaf, score: 66.32	N	N	N	N
vg0918268132	C -> T	LOC_Os09g30030.1	upstream_gene_variant ; 992.0bp to feature; MODIFIER	silent_mutation	Average:48.175; most accessible tissue: Zhenshan97 young leaf, score: 66.32	N	N	N	N
vg0918268132	C -> T	LOC_Os09g30040.1	upstream_gene_variant ; 4489.0bp to feature; MODIFIER	silent_mutation	Average:48.175; most accessible tissue: Zhenshan97 young leaf, score: 66.32	N	N	N	N
vg0918268132	C -> T	LOC_Os09g30020-LOC_Os09g30030	intergenic_region ; MODIFIER	silent_mutation	Average:48.175; most accessible tissue: Zhenshan97 young leaf, score: 66.32	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0918268132	NA	1.02E-08	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918268132	NA	3.69E-08	mr1189_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918268132	NA	2.51E-07	mr1291_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918268132	NA	1.60E-06	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918268132	NA	4.49E-06	mr1479_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918268132	NA	5.54E-08	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918268132	NA	8.71E-10	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918268132	NA	9.88E-06	mr1722_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918268132	8.40E-06	1.51E-11	mr1808_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918268132	NA	4.04E-06	mr1892_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251