Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0917631772:

Variant ID: vg0917631772 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 17631772
Reference Allele: A	Alternative Allele: T,C
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, T: 0.05, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

CGTAGCCGATCTGGACTTCAGCCGATTCTTGCTCTGTTCTCGGATCAATCTTCGCCTTCGACTCCACCTTGATCTAATATCCTTTTCCGATGCTGATATT[A/T,C]
GCAAATTTGGTCGTTAACACATGCCCCCCAAGTCCGGGATATTTGATAATGTTCCGGATTTGCTGTGTACCGACTCCGAGCAAGTCTCGCACTCTGCCGT

Reverse complement sequence

ACGGCAGAGTGCGAGACTTGCTCGGAGTCGGTACACAGCAAATCCGGAACATTATCAAATATCCCGGACTTGGGGGGCATGTGTTAACGACCAAATTTGC[T/A,G]
AATATCAGCATCGGAAAAGGATATTAGATCAAGGTGGAGTCGAAGGCGAAGATTGATCCGAGAACAGAGCAAGAATCGGCTGAAGTCCAGATCGGCTACG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.10%	42.80%	0.04%	0.00%	C: 0.02%
All Indica	2759	96.40%	3.50%	0.04%	0.00%	C: 0.04%
All Japonica	1512	0.50%	99.50%	0.00%	0.00%	NA
Aus	269	1.10%	98.50%	0.37%	0.00%	NA
Indica I	595	99.20%	0.80%	0.00%	0.00%	NA
Indica II	465	95.30%	4.50%	0.22%	0.00%	NA
Indica III	913	97.80%	2.10%	0.00%	0.00%	C: 0.11%
Indica Intermediate	786	93.40%	6.60%	0.00%	0.00%	NA
Temperate Japonica	767	0.10%	99.90%	0.00%	0.00%	NA
Tropical Japonica	504	0.60%	99.40%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	98.80%	0.00%	0.00%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	27.80%	72.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0917631772	A -> T	LOC_Os09g29000.1	upstream_gene_variant ; 1561.0bp to feature; MODIFIER	silent_mutation	Average:43.753; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N
vg0917631772	A -> T	LOC_Os09g29010.1	upstream_gene_variant ; 278.0bp to feature; MODIFIER	silent_mutation	Average:43.753; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N
vg0917631772	A -> T	LOC_Os09g29030.1	upstream_gene_variant ; 3853.0bp to feature; MODIFIER	silent_mutation	Average:43.753; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N
vg0917631772	A -> T	LOC_Os09g29020.1	downstream_gene_variant ; 2045.0bp to feature; MODIFIER	silent_mutation	Average:43.753; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N
vg0917631772	A -> T	LOC_Os09g29000-LOC_Os09g29010	intergenic_region ; MODIFIER	silent_mutation	Average:43.753; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N
vg0917631772	A -> C	LOC_Os09g29000.1	upstream_gene_variant ; 1561.0bp to feature; MODIFIER	silent_mutation	Average:43.753; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N
vg0917631772	A -> C	LOC_Os09g29010.1	upstream_gene_variant ; 278.0bp to feature; MODIFIER	silent_mutation	Average:43.753; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N
vg0917631772	A -> C	LOC_Os09g29030.1	upstream_gene_variant ; 3853.0bp to feature; MODIFIER	silent_mutation	Average:43.753; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N
vg0917631772	A -> C	LOC_Os09g29020.1	downstream_gene_variant ; 2045.0bp to feature; MODIFIER	silent_mutation	Average:43.753; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N
vg0917631772	A -> C	LOC_Os09g29000-LOC_Os09g29010	intergenic_region ; MODIFIER	silent_mutation	Average:43.753; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0917631772	NA	6.97E-07	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	1.03E-10	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	4.04E-51	mr1063	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	7.74E-10	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	8.82E-17	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	5.39E-07	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	4.38E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	1.29E-30	mr1221	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	8.28E-31	mr1224	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	1.10E-08	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	4.97E-15	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	6.29E-13	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	1.70E-19	mr1422	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	4.15E-07	4.15E-07	mr1444	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	6.45E-13	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	9.95E-06	9.95E-06	mr1452	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	4.48E-13	mr1531	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	2.19E-25	mr1571	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	6.96E-06	NA	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	6.79E-07	6.79E-07	mr1623	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	1.04E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	6.51E-06	mr1625	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	6.45E-07	NA	mr1630	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	1.39E-08	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	1.09E-09	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	2.40E-06	NA	mr1732	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	5.09E-13	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	3.99E-06	mr1782	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	1.24E-07	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	2.85E-08	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	7.99E-07	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	5.48E-10	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	5.13E-12	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	5.76E-22	mr1164_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	4.66E-13	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	2.85E-13	mr1514_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	7.19E-19	mr1531_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	1.58E-32	mr1571_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	1.43E-09	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	3.69E-15	mr1686_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	5.87E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	8.25E-11	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	6.94E-19	mr1744_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	1.14E-08	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	1.57E-10	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772	NA	1.20E-08	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251