Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0917229302:

Variant ID: vg0917229302 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 17229302
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCCAATGAGTTGCCCTGAAAATGACCTGCATATAGGAAAATGATGGTGATTTGTCAAAAACCATATCATTCCTACTCAGCCATATTGCCCAACAAATG[G/A]
TAGAAGCTCCAACAAGTATCAGTTTACCCATTTTCTTATCAACTCCCAAAAGCCACCCATTAAAAATATGAGATATGCTAACTGGAAGATTAAAACCAAA

Reverse complement sequence

TTTGGTTTTAATCTTCCAGTTAGCATATCTCATATTTTTAATGGGTGGCTTTTGGGAGTTGATAAGAAAATGGGTAAACTGATACTTGTTGGAGCTTCTA[C/T]
CATTTGTTGGGCAATATGGCTGAGTAGGAATGATATGGTTTTTGACAAATCACCATCATTTTCCTATATGCAGGTCATTTTCAGGGCAACTCATTGGCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.90% 9.50% 1.67% 0.00% NA
All Indica  2759 81.30% 15.90% 2.79% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.50% 0.70% 0.84% 0.00% NA
Indica II  465 38.50% 52.90% 8.60% 0.00% NA
Indica III  913 95.10% 4.60% 0.33% 0.00% NA
Indica Intermediate  786 77.60% 18.70% 3.69% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 8.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0917229302 G -> A LOC_Os09g28354.1 downstream_gene_variant ; 341.0bp to feature; MODIFIER silent_mutation Average:55.598; most accessible tissue: Zhenshan97 flag leaf, score: 85.761 N N N N
vg0917229302 G -> A LOC_Os09g28370.1 downstream_gene_variant ; 1996.0bp to feature; MODIFIER silent_mutation Average:55.598; most accessible tissue: Zhenshan97 flag leaf, score: 85.761 N N N N
vg0917229302 G -> A LOC_Os09g28354-LOC_Os09g28370 intergenic_region ; MODIFIER silent_mutation Average:55.598; most accessible tissue: Zhenshan97 flag leaf, score: 85.761 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0917229302 G A 0.04 0.07 0.05 -0.02 0.04 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0917229302 NA 6.67E-09 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917229302 NA 9.88E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917229302 NA 1.75E-07 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917229302 7.63E-06 1.60E-13 mr1557 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917229302 3.50E-06 NA mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917229302 NA 8.81E-11 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917229302 NA 1.66E-08 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917229302 NA 2.77E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917229302 NA 2.50E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917229302 NA 7.42E-07 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917229302 NA 1.03E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917229302 NA 2.51E-10 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917229302 NA 9.31E-14 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917229302 NA 6.92E-10 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917229302 NA 1.90E-07 mr1733_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917229302 NA 4.34E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251