Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916698836:

Variant ID: vg0916698836 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16698836
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCCCCGCGCGTACGCGCGCACACAACGCAATGAAACCACCCCCATGCATGCGCCGTGCCGCGTCATGACGAGCTATGGCTAGCGGTAGCACTCGATCGG[T/C]
TCAGCGCGTGAGCGTGACTGCGTGAGCTATCGCAGGAGCAGCACCTGATCCGAGCCCCGATCCACCGGCCGCGTGCCGGATCACGGGCTCTTCCCACGCA

Reverse complement sequence

TGCGTGGGAAGAGCCCGTGATCCGGCACGCGGCCGGTGGATCGGGGCTCGGATCAGGTGCTGCTCCTGCGATAGCTCACGCAGTCACGCTCACGCGCTGA[A/G]
CCGATCGAGTGCTACCGCTAGCCATAGCTCGTCATGACGCGGCACGGCGCATGCATGGGGGTGGTTTCATTGCGTTGTGTGCGCGCGTACGCGCGGGGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.10% 33.10% 0.80% 0.00% NA
All Indica  2759 97.20% 2.40% 0.40% 0.00% NA
All Japonica  1512 9.10% 89.20% 1.65% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.20% 0.00% 0.84% 0.00% NA
Indica II  465 92.70% 7.10% 0.22% 0.00% NA
Indica III  913 99.60% 0.20% 0.22% 0.00% NA
Indica Intermediate  786 95.50% 4.10% 0.38% 0.00% NA
Temperate Japonica  767 6.60% 91.90% 1.43% 0.00% NA
Tropical Japonica  504 4.60% 95.40% 0.00% 0.00% NA
Japonica Intermediate  241 26.60% 67.60% 5.81% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 33.30% 64.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916698836 T -> C LOC_Os09g27480.1 upstream_gene_variant ; 1413.0bp to feature; MODIFIER silent_mutation Average:94.956; most accessible tissue: Zhenshan97 panicle, score: 98.915 N N N N
vg0916698836 T -> C LOC_Os09g27480-LOC_Os09g27490 intergenic_region ; MODIFIER silent_mutation Average:94.956; most accessible tissue: Zhenshan97 panicle, score: 98.915 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0916698836 T C -0.04 -0.02 0.02 0.01 -0.04 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916698836 NA 7.66E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916698836 NA 1.17E-16 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916698836 NA 3.48E-14 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916698836 NA 8.51E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916698836 NA 2.04E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916698836 NA 5.96E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916698836 NA 2.33E-11 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916698836 NA 2.84E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916698836 NA 1.52E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916698836 7.18E-06 NA mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916698836 NA 8.60E-06 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916698836 6.74E-07 NA mr1693 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916698836 NA 2.05E-09 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916698836 NA 5.60E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916698836 NA 4.90E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916698836 NA 2.62E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916698836 NA 5.00E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916698836 NA 9.23E-16 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916698836 NA 4.99E-15 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251