Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916693881:

Variant ID: vg0916693881 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16693881
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATATGCAGTCGTTCGAGGGTACTCCCTCCGTTCACAATACAAGGGATTTTGAGTTTTTAATTGTAACGTTTGACCACTCGTCTTATTCAAATTTTTTTG[C/T]
AAATATAAAAAACGTAAAGTTGTGCTTAAAGTACTGTAGATAATAAGGTAAGTCACAAATAAAATAAATAATAATTTCAAAAAATTTTGAATAAGACGAG

Reverse complement sequence

CTCGTCTTATTCAAAATTTTTTGAAATTATTATTTATTTTATTTGTGACTTACCTTATTATCTACAGTACTTTAAGCACAACTTTACGTTTTTTATATTT[G/A]
CAAAAAAATTTGAATAAGACGAGTGGTCAAACGTTACAATTAAAAACTCAAAATCCCTTGTATTGTGAACGGAGGGAGTACCCTCGAACGACTGCATATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.40% 33.40% 0.08% 0.11% NA
All Indica  2759 98.80% 1.00% 0.00% 0.18% NA
All Japonica  1512 4.00% 96.00% 0.07% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 98.70% 0.70% 0.00% 0.67% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 98.50% 1.40% 0.00% 0.13% NA
Temperate Japonica  767 4.30% 95.60% 0.13% 0.00% NA
Tropical Japonica  504 2.20% 97.80% 0.00% 0.00% NA
Japonica Intermediate  241 6.60% 93.40% 0.00% 0.00% NA
VI/Aromatic  96 47.90% 52.10% 0.00% 0.00% NA
Intermediate  90 42.20% 54.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916693881 C -> DEL N N silent_mutation Average:63.648; most accessible tissue: Zhenshan97 panicle, score: 88.888 N N N N
vg0916693881 C -> T LOC_Os09g27480.1 downstream_gene_variant ; 2290.0bp to feature; MODIFIER silent_mutation Average:63.648; most accessible tissue: Zhenshan97 panicle, score: 88.888 N N N N
vg0916693881 C -> T LOC_Os09g27470-LOC_Os09g27480 intergenic_region ; MODIFIER silent_mutation Average:63.648; most accessible tissue: Zhenshan97 panicle, score: 88.888 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0916693881 C T -0.01 -0.01 -0.02 0.02 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916693881 NA 7.40E-12 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0916693881 1.39E-07 1.39E-07 mr1008 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916693881 5.34E-07 5.34E-07 mr1009 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916693881 3.30E-06 3.30E-06 mr1014 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916693881 NA 3.88E-07 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916693881 4.52E-06 1.39E-07 mr1117 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916693881 NA 4.27E-06 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916693881 6.00E-06 6.00E-06 mr1987 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916693881 NA 4.37E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916693881 NA 4.49E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916693881 3.40E-06 1.77E-08 mr1117_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916693881 5.05E-06 3.20E-08 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916693881 1.62E-06 4.69E-07 mr1496_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916693881 NA 1.12E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251