Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916682401:

Variant ID: vg0916682401 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16682401
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.25, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


ATAGTGTAGCTTTCCTCTAGCCGACGTACCCAGGCGAGGGTGGGCGTGATGGAGTTGGGTCGGCCGGGGTGTCCGGTTGATCGGCTTCCGGATTCACCGC[A/G]
GCATGAAAGGGGGGCTGCCCGTTGCCTGCTGGGGACAGGGGCGAACCCTAAGGTGTGGTGCGATCGGTTAGAGGGGGGTTATGCGAAGGGTCCTATCACA

Reverse complement sequence

TGTGATAGGACCCTTCGCATAACCCCCCTCTAACCGATCGCACCACACCTTAGGGTTCGCCCCTGTCCCCAGCAGGCAACGGGCAGCCCCCCTTTCATGC[T/C]
GCGGTGAATCCGGAAGCCGATCAACCGGACACCCCGGCCGACCCAACTCCATCACGCCCACCCTCGCCTGGGTACGTCGGCTAGAGGAAAGCTACACTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.00% 33.80% 0.15% 0.00% NA
All Indica  2759 98.30% 1.60% 0.18% 0.00% NA
All Japonica  1512 3.40% 96.50% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.30% 1.20% 0.50% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 97.70% 2.00% 0.25% 0.00% NA
Temperate Japonica  767 3.30% 96.70% 0.00% 0.00% NA
Tropical Japonica  504 2.00% 97.80% 0.20% 0.00% NA
Japonica Intermediate  241 7.10% 92.90% 0.00% 0.00% NA
VI/Aromatic  96 52.10% 47.90% 0.00% 0.00% NA
Intermediate  90 43.30% 55.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916682401 A -> G LOC_Os09g27460.1 upstream_gene_variant ; 1038.0bp to feature; MODIFIER silent_mutation Average:44.226; most accessible tissue: Zhenshan97 flag leaf, score: 64.225 N N N N
vg0916682401 A -> G LOC_Os09g27470.1 downstream_gene_variant ; 496.0bp to feature; MODIFIER silent_mutation Average:44.226; most accessible tissue: Zhenshan97 flag leaf, score: 64.225 N N N N
vg0916682401 A -> G LOC_Os09g27460-LOC_Os09g27470 intergenic_region ; MODIFIER silent_mutation Average:44.226; most accessible tissue: Zhenshan97 flag leaf, score: 64.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916682401 5.07E-07 5.07E-07 mr1008 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 1.21E-06 1.21E-06 mr1009 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 NA 1.49E-32 mr1081 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 NA 9.98E-23 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 NA 1.31E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 NA 8.19E-45 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 NA 8.42E-44 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 NA 2.03E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 NA 3.21E-17 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 NA 7.57E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 NA 1.47E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 2.21E-06 2.21E-06 mr1529 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 NA 1.26E-35 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 NA 4.88E-67 mr1619 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 NA 1.43E-36 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 NA 5.86E-59 mr1711 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 NA 4.38E-26 mr1731 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 NA 2.48E-13 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 NA 2.34E-52 mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 NA 1.72E-67 mr1896 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 NA 3.17E-25 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 NA 4.76E-14 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 NA 4.43E-06 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 5.17E-06 5.17E-06 mr1987 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 NA 4.30E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 NA 1.07E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916682401 5.77E-06 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251