Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916156198:

Variant ID: vg0916156198 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 16156198
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

ATCTTGTTCGTGACCTAAGGTCACAACACATATAATCAAAACATACTCTCACTTAATTATACAACTTCAGTGTATGTTATTTTCTATCGAAGCTAAGAGT[A/T]
AAATAAATGTAATACTCAACCAATAAACTGACCTTATGTTCTGTTAAAGTAATAATCGTTTTAGTAATTCTTGAAATAAAAATCTTCAACCGCATATTCT

Reverse complement sequence

AGAATATGCGGTTGAAGATTTTTATTTCAAGAATTACTAAAACGATTATTACTTTAACAGAACATAAGGTCAGTTTATTGGTTGAGTATTACATTTATTT[T/A]
ACTCTTAGCTTCGATAGAAAATAACATACACTGAAGTTGTATAATTAAGTGAGAGTATGTTTTGATTATATGTGTTGTGACCTTAGGTCACGAACAAGAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.90%	7.50%	0.61%	0.00%	NA
All Indica	2759	99.80%	0.20%	0.04%	0.00%	NA
All Japonica	1512	75.40%	22.90%	1.72%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.20%	0.22%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.40%	0.00%	0.00%	NA
Temperate Japonica	767	96.50%	2.50%	1.04%	0.00%	NA
Tropical Japonica	504	46.80%	51.40%	1.79%	0.00%	NA
Japonica Intermediate	241	68.00%	28.20%	3.73%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	94.40%	3.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0916156198	A -> T	LOC_Os09g26630.1	upstream_gene_variant ; 1445.0bp to feature; MODIFIER	silent_mutation	Average:39.082; most accessible tissue: Callus, score: 70.442	N	N	N	N
vg0916156198	A -> T	LOC_Os09g26620.1	downstream_gene_variant ; 1028.0bp to feature; MODIFIER	silent_mutation	Average:39.082; most accessible tissue: Callus, score: 70.442	N	N	N	N
vg0916156198	A -> T	LOC_Os09g26620.5	downstream_gene_variant ; 1028.0bp to feature; MODIFIER	silent_mutation	Average:39.082; most accessible tissue: Callus, score: 70.442	N	N	N	N
vg0916156198	A -> T	LOC_Os09g26620.2	downstream_gene_variant ; 1028.0bp to feature; MODIFIER	silent_mutation	Average:39.082; most accessible tissue: Callus, score: 70.442	N	N	N	N
vg0916156198	A -> T	LOC_Os09g26620.3	downstream_gene_variant ; 1028.0bp to feature; MODIFIER	silent_mutation	Average:39.082; most accessible tissue: Callus, score: 70.442	N	N	N	N
vg0916156198	A -> T	LOC_Os09g26620.4	downstream_gene_variant ; 1028.0bp to feature; MODIFIER	silent_mutation	Average:39.082; most accessible tissue: Callus, score: 70.442	N	N	N	N
vg0916156198	A -> T	LOC_Os09g26620-LOC_Os09g26630	intergenic_region ; MODIFIER	silent_mutation	Average:39.082; most accessible tissue: Callus, score: 70.442	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0916156198	7.62E-06	NA	mr1525	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916156198	2.14E-07	1.74E-10	mr1696	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916156198	NA	2.26E-09	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916156198	NA	5.84E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251