Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916129842:

Variant ID: vg0916129842 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16129842
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCAGGTACCTCGCGCCCGCGATCTACGCCGACGCCGGTGAGGGCGGAGAGCGTCGGCTCGTCGGTCTATCCCGCAGTCAACGCTGTGGATATGGTAGCA[G/T]
ATGGAGCGCAGGGGGGTTTAGGGTTTCCGGAGGTGCCGCCAGGTTTTGAGAAGGTCAAAGCGGAGCCGGCTCCAGCTACACCCGCGCCAGTGGCTTCTCC

Reverse complement sequence

GGAGAAGCCACTGGCGCGGGTGTAGCTGGAGCCGGCTCCGCTTTGACCTTCTCAAAACCTGGCGGCACCTCCGGAAACCCTAAACCCCCCTGCGCTCCAT[C/A]
TGCTACCATATCCACAGCGTTGACTGCGGGATAGACCGACGAGCCGACGCTCTCCGCCCTCACCGGCGTCGGCGTAGATCGCGGGCGCGAGGTACCTGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.20% 4.70% 0.08% 0.00% NA
All Indica  2759 92.40% 7.50% 0.07% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 95.90% 3.30% 0.74% 0.00% NA
Indica I  595 72.80% 26.90% 0.34% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 95.20% 4.80% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916129842 G -> T LOC_Os09g26600.1 missense_variant ; p.Asp76Tyr; MODERATE nonsynonymous_codon ; D76Y Average:72.376; most accessible tissue: Minghui63 panicle, score: 86.012 unknown unknown DELETERIOUS 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916129842 NA 2.45E-07 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916129842 NA 8.86E-07 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916129842 NA 1.08E-07 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916129842 NA 6.02E-06 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916129842 7.80E-07 1.48E-06 mr1561 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916129842 1.13E-06 1.00E-16 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916129842 NA 1.08E-10 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916129842 4.27E-07 2.18E-18 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916129842 NA 1.36E-12 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916129842 NA 1.36E-11 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916129842 NA 3.56E-09 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916129842 NA 9.84E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916129842 NA 4.65E-08 mr1006_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916129842 NA 1.70E-06 mr1006_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916129842 NA 3.39E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916129842 NA 8.10E-15 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916129842 NA 1.62E-09 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916129842 NA 4.06E-19 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916129842 NA 1.77E-12 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916129842 NA 3.51E-12 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916129842 NA 2.42E-10 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916129842 NA 4.33E-08 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916129842 NA 5.41E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916129842 NA 3.80E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251