Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916047534:

Variant ID: vg0916047534 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 16047534
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTAAGCTTTGTGTTCATCCATCTAGTGTGTTAGAGGGTTGATTAGCCAAGAGTCAAGTGCATTGCTTCCATTATAGAGCTAGTGTGGCACTTGATTGAT[C/T]
ATCTCCACGCCGGGTCATTGCTTGTTACTCTTGGAGGTTGCCGCCTCCTAGACGGCTTGTGGAGGAGTTGCCCGGTGACCTCTCCGAGAAGATTGTGGAG

Reverse complement sequence

CTCCACAATCTTCTCGGAGAGGTCACCGGGCAACTCCTCCACAAGCCGTCTAGGAGGCGGCAACCTCCAAGAGTAACAAGCAATGACCCGGCGTGGAGAT[G/A]
ATCAATCAAGTGCCACACTAGCTCTATAATGGAAGCAATGCACTTGACTCTTGGCTAATCAACCCTCTAACACACTAGATGGATGAACACAAAGCTTAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.30%	6.30%	2.16%	49.24%	NA
All Indica	2759	9.90%	10.40%	3.66%	76.04%	NA
All Japonica	1512	99.30%	0.00%	0.00%	0.66%	NA
Aus	269	26.40%	1.90%	0.00%	71.75%	NA
Indica I	595	8.20%	33.40%	6.05%	52.27%	NA
Indica II	465	13.30%	1.90%	3.66%	81.08%	NA
Indica III	913	5.90%	0.50%	2.19%	91.35%	NA
Indica Intermediate	786	13.70%	9.40%	3.56%	73.28%	NA
Temperate Japonica	767	99.60%	0.00%	0.00%	0.39%	NA
Tropical Japonica	504	98.80%	0.00%	0.00%	1.19%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	97.90%	1.00%	0.00%	1.04%	NA
Intermediate	90	67.80%	3.30%	1.11%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0916047534	C -> DEL	N	N	silent_mutation	Average:19.747; most accessible tissue: Minghui63 root, score: 45.031	N	N	N	N
vg0916047534	C -> T	LOC_Os09g26540.1	upstream_gene_variant ; 2067.0bp to feature; MODIFIER	silent_mutation	Average:19.747; most accessible tissue: Minghui63 root, score: 45.031	N	N	N	N
vg0916047534	C -> T	LOC_Os09g26550.2	upstream_gene_variant ; 1604.0bp to feature; MODIFIER	silent_mutation	Average:19.747; most accessible tissue: Minghui63 root, score: 45.031	N	N	N	N
vg0916047534	C -> T	LOC_Os09g26540.2	upstream_gene_variant ; 2067.0bp to feature; MODIFIER	silent_mutation	Average:19.747; most accessible tissue: Minghui63 root, score: 45.031	N	N	N	N
vg0916047534	C -> T	LOC_Os09g26540-LOC_Os09g26550	intergenic_region ; MODIFIER	silent_mutation	Average:19.747; most accessible tissue: Minghui63 root, score: 45.031	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0916047534	NA	5.22E-06	mr1686	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534	NA	4.25E-10	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534	NA	1.99E-06	mr1707	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534	NA	7.65E-11	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534	NA	1.33E-07	mr1728	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534	NA	1.03E-11	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534	NA	4.67E-09	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534	3.91E-06	3.91E-06	mr1966	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534	NA	4.12E-06	mr1348_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534	NA	2.96E-06	mr1349_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534	NA	2.33E-06	mr1728_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534	NA	1.21E-08	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534	NA	1.21E-06	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534	NA	2.12E-07	mr1895_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251