Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0915800892:

Variant ID: vg0915800892 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 15800892
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAACACCCCATCTTTATTCGGTCGGTACTCTTCCTGCATAACTGAATAAAAAAGCCTGTTACTAGCAGGGTTTACATTACCGTCGGTAGCCGATAGCCTC[G/A]
CGGTTACTGGCCTTACCGTGGGGGTATGGTAATAGAAAAACCACGGTTACCTCTTTAAATTCATATAATTAAAAAAAACAATTTGAATTTTTGATAAATT

Reverse complement sequence

AATTTATCAAAAATTCAAATTGTTTTTTTTAATTATATGAATTTAAAGAGGTAACCGTGGTTTTTCTATTACCATACCCCCACGGTAAGGCCAGTAACCG[C/T]
GAGGCTATCGGCTACCGACGGTAATGTAAACCCTGCTAGTAACAGGCTTTTTTATTCAGTTATGCAGGAAGAGTACCGACCGAATAAAGATGGGGTGTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.90% 10.40% 0.68% 0.00% NA
All Indica  2759 99.60% 0.40% 0.04% 0.00% NA
All Japonica  1512 69.80% 28.10% 2.05% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.50% 0.13% 0.00% NA
Temperate Japonica  767 75.70% 21.30% 3.00% 0.00% NA
Tropical Japonica  504 71.40% 28.00% 0.60% 0.00% NA
Japonica Intermediate  241 47.70% 50.20% 2.07% 0.00% NA
VI/Aromatic  96 59.40% 40.60% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0915800892 G -> A LOC_Os09g26190.1 3_prime_UTR_variant ; 608.0bp to feature; MODIFIER silent_mutation Average:86.664; most accessible tissue: Zhenshan97 panicle, score: 96.894 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0915800892 G A 0.02 0.0 0.01 0.02 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0915800892 NA 5.34E-07 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915800892 NA 7.15E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915800892 3.23E-07 3.21E-07 mr1197_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915800892 NA 7.54E-09 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915800892 NA 1.20E-08 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915800892 NA 2.22E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915800892 NA 6.63E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915800892 NA 7.94E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915800892 NA 3.87E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915800892 NA 2.40E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915800892 NA 1.49E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915800892 NA 6.12E-13 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915800892 NA 3.33E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915800892 NA 1.52E-08 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915800892 NA 8.92E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251