Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0915107312:

Variant ID: vg0915107312 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 15107312
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

TATATATCGATATAAGAACTATATATTGGTAATTTCTACAGCCGATCGAGTAGGTTTAGTTCTTTATTATCTATTTATAGTCGCCGATCGATTCATATAT[G/A]
ACATCGGCTCAAAGATAAATGATATGTCATCGGCACTTAGCCGATCGGCTATCATTTATAGATTTAACCGCGATCTCTTTGTTTCTATTTCTTGTTGATT

Reverse complement sequence

AATCAACAAGAAATAGAAACAAAGAGATCGCGGTTAAATCTATAAATGATAGCCGATCGGCTAAGTGCCGATGACATATCATTTATCTTTGAGCCGATGT[C/T]
ATATATGAATCGATCGGCGACTATAAATAGATAATAAAGAACTAAACCTACTCGATCGGCTGTAGAAATTACCAATATATAGTTCTTATATCGATATATA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.50%	35.70%	2.52%	0.36%	NA
All Indica	2759	98.60%	0.90%	0.43%	0.00%	NA
All Japonica	1512	1.10%	98.90%	0.07%	0.00%	NA
Aus	269	50.60%	4.50%	38.66%	6.32%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	99.10%	0.20%	0.66%	0.00%	NA
Indica Intermediate	786	97.80%	1.40%	0.76%	0.00%	NA
Temperate Japonica	767	0.80%	99.20%	0.00%	0.00%	NA
Tropical Japonica	504	0.60%	99.20%	0.20%	0.00%	NA
Japonica Intermediate	241	2.90%	97.10%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	96.90%	1.04%	0.00%	NA
Intermediate	90	33.30%	65.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0915107312	G -> DEL	N	N	silent_mutation	Average:25.169; most accessible tissue: Zhenshan97 root, score: 46.166	N	N	N	N
vg0915107312	G -> A	LOC_Os09g25220.1	upstream_gene_variant ; 3774.0bp to feature; MODIFIER	silent_mutation	Average:25.169; most accessible tissue: Zhenshan97 root, score: 46.166	N	N	N	N
vg0915107312	G -> A	LOC_Os09g25210-LOC_Os09g25220	intergenic_region ; MODIFIER	silent_mutation	Average:25.169; most accessible tissue: Zhenshan97 root, score: 46.166	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0915107312	NA	3.44E-10	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107312	NA	1.09E-27	mr1074_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107312	NA	6.34E-36	mr1081_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107312	NA	8.45E-09	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107312	NA	3.92E-13	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107312	NA	1.15E-17	mr1148_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107312	NA	4.68E-39	mr1152_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107312	NA	1.23E-49	mr1154_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107312	NA	4.40E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107312	NA	3.00E-08	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107312	NA	7.09E-13	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107312	NA	3.93E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107312	1.03E-06	1.33E-39	mr1256_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107312	NA	7.31E-08	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107312	NA	6.71E-08	mr1335_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107312	NA	1.78E-25	mr1386_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107312	NA	1.00E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107312	NA	1.47E-10	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107312	NA	2.26E-14	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107312	NA	2.15E-09	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107312	NA	1.19E-08	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107312	NA	7.59E-12	mr1781_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107312	NA	6.46E-33	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107312	NA	7.19E-20	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915107312	NA	4.23E-43	mr1944_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251