Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0915105890:

Variant ID: vg0915105890 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 15105890
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACAAGATGATCAGAGTGCGGTCTTGTTCTAGGTCTCGTCCCCCAGTCGACTGCCTGTGGCATGTTAACCGGGCCCTTATATTATTTTGTCTTCCGCTGCT[G/A]
TTCTCTGGTAGTTGTTGGCCTACCTGGCCCTAATGTAAGTATTTAACTCTTTTAACCTGAATTCATTCGTGATATGTTGTGATCCAACTATGTATGTGTG

Reverse complement sequence

CACACATACATAGTTGGATCACAACATATCACGAATGAATTCAGGTTAAAAGAGTTAAATACTTACATTAGGGCCAGGTAGGCCAACAACTACCAGAGAA[C/T]
AGCAGCGGAAGACAAAATAATATAAGGGCCCGGTTAACATGCCACAGGCAGTCGACTGGGGGACGAGACCTAGAACAAGACCGCACTCTGATCATCTTGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.00%	19.10%	2.50%	0.40%	NA
All Indica	2759	71.70%	27.80%	0.47%	0.04%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	7.40%	47.20%	38.66%	6.69%	NA
Indica I	595	82.00%	18.00%	0.00%	0.00%	NA
Indica II	465	76.80%	23.00%	0.22%	0.00%	NA
Indica III	913	62.00%	37.30%	0.66%	0.00%	NA
Indica Intermediate	786	72.30%	26.80%	0.76%	0.13%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	8.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0915105890	G -> DEL	N	N	silent_mutation	Average:26.283; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0915105890	G -> A	LOC_Os09g25210.1	upstream_gene_variant ; 3786.0bp to feature; MODIFIER	silent_mutation	Average:26.283; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0915105890	G -> A	LOC_Os09g25210-LOC_Os09g25220	intergenic_region ; MODIFIER	silent_mutation	Average:26.283; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0915105890	NA	6.54E-06	mr1185_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915105890	NA	5.98E-06	mr1269_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915105890	NA	4.09E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251