Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0914141146:

Variant ID: vg0914141146 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 14141146
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.29, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTATAAAATAGGATGCTGACCGGACTACCACGTGTACGCCACGTAGACCAAAACCACCACGGATTCGGTCGGGGGGAGGGGTAATTCGTCCGGTTTG[C/T]
ATAGTTGGGAGTGAAGAATGTTCGGTTTTATGGTTCTGAGGGTAATTCGGACGACTATGATAGTTCGGGGGAAGATAATTCGTACTTTTTAGTCAGGAGC

Reverse complement sequence

GCTCCTGACTAAAAAGTACGAATTATCTTCCCCCGAACTATCATAGTCGTCCGAATTACCCTCAGAACCATAAAACCGAACATTCTTCACTCCCAACTAT[G/A]
CAAACCGGACGAATTACCCCTCCCCCCGACCGAATCCGTGGTGGTTTTGGTCTACGTGGCGTACACGTGGTAGTCCGGTCAGCATCCTATTTTATAAAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.60% 48.20% 0.15% 0.00% NA
All Indica  2759 79.90% 20.00% 0.04% 0.00% NA
All Japonica  1512 0.80% 99.10% 0.13% 0.00% NA
Aus  269 72.90% 27.10% 0.00% 0.00% NA
Indica I  595 52.90% 47.10% 0.00% 0.00% NA
Indica II  465 72.30% 27.50% 0.22% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 82.30% 17.70% 0.00% 0.00% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.00% 0.20% 0.00% NA
Japonica Intermediate  241 1.20% 98.30% 0.41% 0.00% NA
VI/Aromatic  96 1.00% 96.90% 2.08% 0.00% NA
Intermediate  90 28.90% 68.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0914141146 C -> T LOC_Os09g23760.1 downstream_gene_variant ; 1769.0bp to feature; MODIFIER silent_mutation Average:71.065; most accessible tissue: Minghui63 flag leaf, score: 93.631 N N N N
vg0914141146 C -> T LOC_Os09g23750-LOC_Os09g23760 intergenic_region ; MODIFIER silent_mutation Average:71.065; most accessible tissue: Minghui63 flag leaf, score: 93.631 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0914141146 C T 0.06 0.05 0.06 0.04 0.06 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0914141146 NA 2.73E-16 mr1170 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914141146 NA 4.86E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914141146 NA 1.05E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914141146 NA 1.85E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914141146 NA 2.96E-11 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914141146 NA 3.73E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914141146 NA 2.25E-06 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914141146 NA 9.11E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914141146 NA 6.57E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914141146 NA 1.73E-06 mr1511_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914141146 NA 1.51E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914141146 NA 4.68E-08 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251