| Variant ID: vg0913099185 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 13099185 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.02, others allele: 0.00, population size: 82. )
CCTTAAATGACCTCAAATAATAAAATAGTCAATAAGAAAGTTGTAGATCTCATCGAGCTCTACAATGTTGATATAAAGTTTGTCGCCATCTGATTCCATA[T/A]
GAAAAAGTTATGTATATATACATGTTTTTTCTAAACTTTGCTCAATGTCTGCGGATATCTGAAAAAAAATCCGGATAGTTTTTCCGACCGTTTTCTGATT
AATCAGAAAACGGTCGGAAAAACTATCCGGATTTTTTTTCAGATATCCGCAGACATTGAGCAAAGTTTAGAAAAAACATGTATATATACATAACTTTTTC[A/T]
TATGGAATCAGATGGCGACAAACTTTATATCAACATTGTAGAGCTCGATGAGATCTACAACTTTCTTATTGACTATTTTATTATTTGAGGTCATTTAAGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.60% | 23.40% | 6.07% | 12.93% | NA |
| All Indica | 2759 | 87.10% | 12.20% | 0.14% | 0.54% | NA |
| All Japonica | 1512 | 9.00% | 43.00% | 18.19% | 29.83% | NA |
| Aus | 269 | 48.70% | 5.90% | 0.00% | 45.35% | NA |
| Indica I | 595 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 88.00% | 11.60% | 0.00% | 0.43% | NA |
| Indica III | 913 | 84.30% | 15.20% | 0.00% | 0.44% | NA |
| Indica Intermediate | 786 | 85.40% | 13.00% | 0.51% | 1.15% | NA |
| Temperate Japonica | 767 | 2.70% | 77.60% | 5.22% | 14.47% | NA |
| Tropical Japonica | 504 | 19.40% | 2.20% | 29.17% | 49.21% | NA |
| Japonica Intermediate | 241 | 7.10% | 18.30% | 36.51% | 38.17% | NA |
| VI/Aromatic | 96 | 10.40% | 69.80% | 0.00% | 19.79% | NA |
| Intermediate | 90 | 45.60% | 41.10% | 8.89% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0913099185 | T -> DEL | N | N | silent_mutation | Average:57.882; most accessible tissue: Zhenshan97 flower, score: 81.047 | N | N | N | N |
| vg0913099185 | T -> A | LOC_Os09g21630.1 | downstream_gene_variant ; 259.0bp to feature; MODIFIER | silent_mutation | Average:57.882; most accessible tissue: Zhenshan97 flower, score: 81.047 | N | N | N | N |
| vg0913099185 | T -> A | LOC_Os09g21620-LOC_Os09g21630 | intergenic_region ; MODIFIER | silent_mutation | Average:57.882; most accessible tissue: Zhenshan97 flower, score: 81.047 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0913099185 | NA | 3.72E-06 | mr1111 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913099185 | 2.89E-07 | 2.89E-07 | mr1144 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913099185 | 3.14E-06 | 3.14E-06 | mr1234 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913099185 | NA | 2.24E-06 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913099185 | NA | 3.99E-08 | mr1488 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913099185 | NA | 5.09E-08 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913099185 | NA | 3.36E-06 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913099185 | NA | 2.86E-07 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913099185 | NA | 3.40E-07 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913099185 | NA | 4.52E-11 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |