Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912199448:

Variant ID: vg0912199448 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 12199448
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CGTAAACCGGAAAAAAAAGCGAAAAAAAGGAAAAACTCTCAGGCTATCGCGTCTGCGCGTGCGTGGGCCTTGGCGGCGTCGTACCGGGGCTAGCCCGTGC[G/A]
TGGGCTTTGGCAGCGTCTGCGCCGGCAACGCGGTTGCGCTAATTAGTTGCGCCCTATCAACTCGTAGCCTTGATAAAATAAAATTTTGCTACATGAGGAT

Reverse complement sequence

ATCCTCATGTAGCAAAATTTTATTTTATCAAGGCTACGAGTTGATAGGGCGCAACTAATTAGCGCAACCGCGTTGCCGGCGCAGACGCTGCCAAAGCCCA[C/T]
GCACGGGCTAGCCCCGGTACGACGCCGCCAAGGCCCACGCACGCGCAGACGCGATAGCCTGAGAGTTTTTCCTTTTTTTCGCTTTTTTTTCCGGTTTACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.80% 41.60% 0.51% 0.08% NA
All Indica  2759 29.20% 70.00% 0.72% 0.14% NA
All Japonica  1512 99.10% 0.70% 0.20% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 3.50% 95.60% 0.84% 0.00% NA
Indica II  465 60.20% 39.10% 0.65% 0.00% NA
Indica III  913 29.00% 70.30% 0.55% 0.11% NA
Indica Intermediate  786 30.40% 68.30% 0.89% 0.38% NA
Temperate Japonica  767 99.30% 0.50% 0.13% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 97.90% 1.70% 0.41% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 81.10% 17.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0912199448 G -> DEL N N silent_mutation Average:33.622; most accessible tissue: Callus, score: 64.349 N N N N
vg0912199448 G -> A LOC_Os09g20340.1 upstream_gene_variant ; 2952.0bp to feature; MODIFIER silent_mutation Average:33.622; most accessible tissue: Callus, score: 64.349 N N N N
vg0912199448 G -> A LOC_Os09g20330.1 downstream_gene_variant ; 1765.0bp to feature; MODIFIER silent_mutation Average:33.622; most accessible tissue: Callus, score: 64.349 N N N N
vg0912199448 G -> A LOC_Os09g20330-LOC_Os09g20340 intergenic_region ; MODIFIER silent_mutation Average:33.622; most accessible tissue: Callus, score: 64.349 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0912199448 NA 6.64E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 9.38E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 3.46E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 1.87E-06 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 5.52E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 3.70E-08 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 1.15E-21 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 7.80E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 9.56E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 1.09E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 3.59E-08 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 6.19E-06 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 6.34E-06 mr1497_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 2.42E-09 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 5.26E-44 mr1598_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 1.64E-11 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 3.58E-09 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 2.27E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 3.69E-17 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 1.16E-14 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 9.80E-06 mr1717_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 2.08E-14 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 3.13E-08 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 2.84E-08 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 1.79E-07 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 5.89E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 1.19E-12 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 5.10E-07 mr1946_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 1.19E-12 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 5.10E-07 mr1948_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912199448 NA 1.93E-06 mr1977_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251