Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0911769544:

Variant ID: vg0911769544 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 11769544
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


CTCCAATTCATCTATAGTCAATCTAATAGCTTATTCATACAATAGTTACATACTACACTATTAATATCTGGTCCCACCTGTCATACACACACTATATCTT[G/A]
GAGTCCGTGATACAGCTGGCTATAAATCTATAGCCCGCTGACTTTCTCTTTTCTTATTTATCTGTTTAAAATATATTTACAGCTAGCTTATAGCCTGCTA

Reverse complement sequence

TAGCAGGCTATAAGCTAGCTGTAAATATATTTTAAACAGATAAATAAGAAAAGAGAAAGTCAGCGGGCTATAGATTTATAGCCAGCTGTATCACGGACTC[C/T]
AAGATATAGTGTGTGTATGACAGGTGGGACCAGATATTAATAGTGTAGTATGTAACTATTGTATGAATAAGCTATTAGATTGACTATAGATGAATTGGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.70% 46.80% 0.17% 1.33% NA
All Indica  2759 32.50% 65.10% 0.14% 2.25% NA
All Japonica  1512 90.10% 9.80% 0.13% 0.00% NA
Aus  269 11.50% 88.10% 0.37% 0.00% NA
Indica I  595 11.60% 88.40% 0.00% 0.00% NA
Indica II  465 54.20% 43.00% 0.22% 2.58% NA
Indica III  913 32.60% 62.30% 0.00% 5.04% NA
Indica Intermediate  786 35.20% 63.90% 0.38% 0.51% NA
Temperate Japonica  767 86.60% 13.20% 0.26% 0.00% NA
Tropical Japonica  504 94.40% 5.60% 0.00% 0.00% NA
Japonica Intermediate  241 92.10% 7.90% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 81.10% 16.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0911769544 G -> DEL N N silent_mutation Average:87.435; most accessible tissue: Callus, score: 97.699 N N N N
vg0911769544 G -> A LOC_Os09g19670.1 intron_variant ; MODIFIER silent_mutation Average:87.435; most accessible tissue: Callus, score: 97.699 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0911769544 G A 0.02 0.01 0.0 0.06 0.04 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0911769544 NA 3.78E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911769544 NA 1.49E-08 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911769544 NA 3.97E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911769544 NA 1.15E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911769544 NA 2.13E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911769544 NA 4.18E-11 mr1660 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911769544 NA 4.62E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911769544 NA 2.54E-06 mr1749 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911769544 NA 3.17E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251