Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0911164560:

Variant ID: vg0911164560 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 11164560
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

TTAAATTGGGACTTATGTCAAATTGAGACTTATGTGAAATTGCGTTAAATTGGGACTTACGTAAAATTGGGACTTATGTCAAATTTTTTTACGTCAAGTT[A/G]
GAAGATGTCGAACTAAAAGGTTCCATCGAACGCACCAATAGCGCCTCAAGAAGGTAACGCTCCTCAAAATTTCGGTAGCAATAAGCAGCCAGACGCTTCT

Reverse complement sequence

AGAAGCGTCTGGCTGCTTATTGCTACCGAAATTTTGAGGAGCGTTACCTTCTTGAGGCGCTATTGGTGCGTTCGATGGAACCTTTTAGTTCGACATCTTC[T/C]
AACTTGACGTAAAAAAATTTGACATAAGTCCCAATTTTACGTAAGTCCCAATTTAACGCAATTTCACATAAGTCTCAATTTGACATAAGTCCCAATTTAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	22.60%	0.40%	19.47%	57.49%	NA
All Indica	2759	3.80%	0.40%	9.13%	86.63%	NA
All Japonica	1512	60.30%	0.20%	28.17%	11.31%	NA
Aus	269	1.90%	1.50%	76.21%	20.45%	NA
Indica I	595	4.20%	0.20%	10.42%	85.21%	NA
Indica II	465	6.70%	0.20%	9.46%	83.66%	NA
Indica III	913	0.80%	0.70%	9.75%	88.83%	NA
Indica Intermediate	786	5.50%	0.40%	7.25%	86.90%	NA
Temperate Japonica	767	64.40%	0.10%	26.47%	9.00%	NA
Tropical Japonica	504	55.20%	0.40%	37.10%	7.34%	NA
Japonica Intermediate	241	58.10%	0.00%	14.94%	26.97%	NA
VI/Aromatic	96	14.60%	1.00%	15.62%	68.75%	NA
Intermediate	90	36.70%	0.00%	24.44%	38.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0911164560	A -> G	LOC_Os09g18220.1	upstream_gene_variant ; 492.0bp to feature; MODIFIER	silent_mutation	Average:11.646; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0911164560	A -> G	LOC_Os09g18210.1	downstream_gene_variant ; 1666.0bp to feature; MODIFIER	silent_mutation	Average:11.646; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0911164560	A -> G	LOC_Os09g18210-LOC_Os09g18220	intergenic_region ; MODIFIER	silent_mutation	Average:11.646; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0911164560	A -> DEL	N	N	silent_mutation	Average:11.646; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0911164560	8.99E-06	NA	mr1768	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911164560	4.28E-06	1.93E-06	mr1768	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251