Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0911067540:

Variant ID: vg0911067540 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 11067540
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTAAAACATATCAACGCACTACTACAAAAGTGATTTTTCTGTGCGAGACCCCATGATTTTTGCAAACGGACCATAACTAGTGGCGCCTGCAAAAATCG[C/T]
GCGGCATTTTCGCAAACAGCTCCTTAAGAAGCCCGTATGGAAAAATCGATTTTCCCATACGGGTCTCTTAAGAGGTCCGCATGCAAAAATGATGTCATGG

Reverse complement sequence

CCATGACATCATTTTTGCATGCGGACCTCTTAAGAGACCCGTATGGGAAAATCGATTTTTCCATACGGGCTTCTTAAGGAGCTGTTTGCGAAAATGCCGC[G/A]
CGATTTTTGCAGGCGCCACTAGTTATGGTCCGTTTGCAAAAATCATGGGGTCTCGCACAGAAAAATCACTTTTGTAGTAGTGCGTTGATATGTTTTAATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.90%	11.80%	0.80%	57.49%	NA
All Indica	2759	3.60%	3.60%	1.16%	91.63%	NA
All Japonica	1512	83.70%	13.30%	0.00%	3.04%	NA
Aus	269	1.10%	77.70%	1.86%	19.33%	NA
Indica I	595	10.40%	3.20%	0.17%	86.22%	NA
Indica II	465	2.40%	6.90%	0.22%	90.54%	NA
Indica III	913	0.80%	1.20%	2.19%	95.84%	NA
Indica Intermediate	786	2.40%	4.80%	1.27%	91.48%	NA
Temperate Japonica	767	85.50%	13.20%	0.00%	1.30%	NA
Tropical Japonica	504	88.70%	5.40%	0.00%	5.95%	NA
Japonica Intermediate	241	67.20%	30.30%	0.00%	2.49%	NA
VI/Aromatic	96	6.20%	41.70%	0.00%	52.08%	NA
Intermediate	90	45.60%	7.80%	1.11%	45.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0911067540	C -> DEL	N	N	silent_mutation	Average:33.242; most accessible tissue: Zhenshan97 flag leaf, score: 53.034	N	N	N	N
vg0911067540	C -> T	LOC_Os09g18050.1	upstream_gene_variant ; 907.0bp to feature; MODIFIER	silent_mutation	Average:33.242; most accessible tissue: Zhenshan97 flag leaf, score: 53.034	N	N	N	N
vg0911067540	C -> T	LOC_Os09g18060.1	downstream_gene_variant ; 3622.0bp to feature; MODIFIER	silent_mutation	Average:33.242; most accessible tissue: Zhenshan97 flag leaf, score: 53.034	N	N	N	N
vg0911067540	C -> T	LOC_Os09g18040-LOC_Os09g18050	intergenic_region ; MODIFIER	silent_mutation	Average:33.242; most accessible tissue: Zhenshan97 flag leaf, score: 53.034	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0911067540	1.85E-06	2.47E-07	mr1210	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911067540	4.22E-06	1.32E-08	mr1305	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911067540	6.29E-06	NA	mr1401	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911067540	NA	2.09E-12	mr1409	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911067540	NA	6.54E-06	mr1585	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911067540	1.02E-06	3.59E-10	mr1586	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911067540	3.83E-06	3.76E-07	mr1305_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911067540	NA	3.31E-13	mr1409_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911067540	NA	5.97E-06	mr1585_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911067540	NA	6.13E-15	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251