Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0911066866:

Variant ID: vg0911066866 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 11066866
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTATAAAACTCATTAAATACAAATCTATAAGTTTACATGTAAATATTCCCTCCGTTTCTAAATGTTTGACACTTTTTAAGCACATGTTTGATCATTCGT[T/C]
TTATTAAAAAAATTTATGAAATATGTAAAATTATATATATACATGAAAGCATATTTAACAATAAATCAAATGATAGGAAAATAATTAATAATTACTTAAA

Reverse complement sequence

TTTAAGTAATTATTAATTATTTTCCTATCATTTGATTTATTGTTAAATATGCTTTCATGTATATATATAATTTTACATATTTCATAAATTTTTTTAATAA[A/G]
ACGAATGATCAAACATGTGCTTAAAAAGTGTCAAACATTTAGAAACGGAGGGAATATTTACATGTAAACTTATAGATTTGTATTTAATGAGTTTTATAGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.90%	11.80%	0.51%	57.79%	NA
All Indica	2759	3.60%	3.60%	0.58%	92.17%	NA
All Japonica	1512	83.70%	13.20%	0.00%	3.04%	NA
Aus	269	0.70%	77.70%	2.23%	19.33%	NA
Indica I	595	10.10%	3.20%	0.34%	86.39%	NA
Indica II	465	2.60%	6.90%	0.00%	90.54%	NA
Indica III	913	0.70%	1.20%	0.99%	97.15%	NA
Indica Intermediate	786	2.80%	4.80%	0.64%	91.73%	NA
Temperate Japonica	767	85.70%	13.00%	0.00%	1.30%	NA
Tropical Japonica	504	88.70%	5.40%	0.00%	5.95%	NA
Japonica Intermediate	241	67.20%	30.30%	0.00%	2.49%	NA
VI/Aromatic	96	6.20%	41.70%	0.00%	52.08%	NA
Intermediate	90	45.60%	7.80%	2.22%	44.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0911066866	T -> DEL	N	N	silent_mutation	Average:16.026; most accessible tissue: Callus, score: 26.434	N	N	N	N
vg0911066866	T -> C	LOC_Os09g18050.1	upstream_gene_variant ; 1581.0bp to feature; MODIFIER	silent_mutation	Average:16.026; most accessible tissue: Callus, score: 26.434	N	N	N	N
vg0911066866	T -> C	LOC_Os09g18060.1	downstream_gene_variant ; 4296.0bp to feature; MODIFIER	silent_mutation	Average:16.026; most accessible tissue: Callus, score: 26.434	N	N	N	N
vg0911066866	T -> C	LOC_Os09g18040-LOC_Os09g18050	intergenic_region ; MODIFIER	silent_mutation	Average:16.026; most accessible tissue: Callus, score: 26.434	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0911066866	4.28E-06	1.15E-06	mr1210	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911066866	6.11E-06	6.11E-06	mr1240	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911066866	6.90E-06	1.66E-07	mr1305	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911066866	NA	4.66E-14	mr1409	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911066866	2.30E-07	2.54E-07	mr1409	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911066866	NA	8.17E-06	mr1585	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911066866	4.43E-06	NA	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911066866	2.50E-06	6.20E-09	mr1586	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911066866	2.14E-06	2.14E-06	mr1738	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911066866	NA	8.41E-06	mr1305_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911066866	NA	1.38E-12	mr1409_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911066866	NA	5.01E-15	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251