Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910735818:

Variant ID: vg0910735818 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10735818
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

CTCAGCGCTACGCGCACGGCTAAGAACCTATCCGAAACACTTAAGTAGCCGTGACCACTACTTACATATTATATTAATTTTGTAGTTGTTGGTAAACAAT[C/T]
GAAACACTTAATAATTAAAGTTCTTTTAGATATTAACTTTTTGGAAGGGTCTATTAGTAAAATTGAAAAAAATAAAAAGTCTAAAAAATAAAAATAAAAA

Reverse complement sequence

TTTTTATTTTTATTTTTTAGACTTTTTATTTTTTTCAATTTTACTAATAGACCCTTCCAAAAAGTTAATATCTAAAAGAACTTTAATTATTAAGTGTTTC[G/A]
ATTGTTTACCAACAACTACAAAATTAATATAATATGTAAGTAGTGGTCACGGCTACTTAAGTGTTTCGGATAGGTTCTTAGCCGTGCGCGTAGCGCTGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.40%	33.50%	0.11%	0.00%	NA
All Indica	2759	45.80%	54.10%	0.14%	0.00%	NA
All Japonica	1512	97.90%	2.10%	0.00%	0.00%	NA
Aus	269	85.50%	14.50%	0.00%	0.00%	NA
Indica I	595	58.20%	41.50%	0.34%	0.00%	NA
Indica II	465	61.70%	38.30%	0.00%	0.00%	NA
Indica III	913	34.70%	65.30%	0.00%	0.00%	NA
Indica Intermediate	786	39.80%	59.90%	0.25%	0.00%	NA
Temperate Japonica	767	98.30%	1.70%	0.00%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	94.20%	5.80%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	80.00%	18.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910735818	C -> T	LOC_Os09g17530.1	upstream_gene_variant ; 2465.0bp to feature; MODIFIER	silent_mutation	Average:63.621; most accessible tissue: Callus, score: 92.229	N	N	N	N
vg0910735818	C -> T	LOC_Os09g17540.1	downstream_gene_variant ; 485.0bp to feature; MODIFIER	silent_mutation	Average:63.621; most accessible tissue: Callus, score: 92.229	N	N	N	N
vg0910735818	C -> T	LOC_Os09g17550.1	downstream_gene_variant ; 2398.0bp to feature; MODIFIER	silent_mutation	Average:63.621; most accessible tissue: Callus, score: 92.229	N	N	N	N
vg0910735818	C -> T	LOC_Os09g17560.1	downstream_gene_variant ; 4522.0bp to feature; MODIFIER	silent_mutation	Average:63.621; most accessible tissue: Callus, score: 92.229	N	N	N	N
vg0910735818	C -> T	LOC_Os09g17540-LOC_Os09g17550	intergenic_region ; MODIFIER	silent_mutation	Average:63.621; most accessible tissue: Callus, score: 92.229	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910735818	NA	2.55E-06	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910735818	NA	3.38E-06	mr1177	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910735818	NA	6.37E-07	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910735818	NA	8.93E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910735818	6.70E-07	1.44E-07	mr1214	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910735818	8.98E-06	8.98E-06	mr1288	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910735818	NA	9.72E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910735818	NA	4.24E-07	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910735818	NA	1.05E-07	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251