Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910385915:

Variant ID: vg0910385915 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10385915
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

GAGTTTATTCAATTTATCTCACAAAAAGATTTGTTTAATTTTGACAACGCCATAATAGGTTCTATATTTATCTCTCATTAATTGTCACGAAACTTAATTT[T/C]
TTATTCATCTGAAAATGGAATCATTATTATTTATATCACTATCAGTCCTCATAGTTTCAACACAGGAAAAAAAACATTGAATAATTAAAGCTGGATAGCT

Reverse complement sequence

AGCTATCCAGCTTTAATTATTCAATGTTTTTTTTCCTGTGTTGAAACTATGAGGACTGATAGTGATATAAATAATAATGATTCCATTTTCAGATGAATAA[A/G]
AAATTAAGTTTCGTGACAATTAATGAGAGATAAATATAGAACCTATTATGGCGTTGTCAAAATTAAACAAATCTTTTTGTGAGATAAATTGAATAAACTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.80%	26.10%	5.16%	36.99%	NA
All Indica	2759	5.10%	42.20%	7.43%	45.27%	NA
All Japonica	1512	79.50%	1.80%	2.05%	16.67%	NA
Aus	269	11.50%	7.10%	0.74%	80.67%	NA
Indica I	595	11.80%	32.10%	12.61%	43.53%	NA
Indica II	465	4.10%	28.40%	7.31%	60.22%	NA
Indica III	913	0.90%	59.10%	3.61%	36.36%	NA
Indica Intermediate	786	5.50%	38.40%	8.02%	48.09%	NA
Temperate Japonica	767	93.20%	0.30%	0.91%	5.61%	NA
Tropical Japonica	504	62.30%	2.40%	3.57%	31.75%	NA
Japonica Intermediate	241	71.80%	5.40%	2.49%	20.33%	NA
VI/Aromatic	96	71.90%	10.40%	4.17%	13.54%	NA
Intermediate	90	65.60%	13.30%	2.22%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910385915	T -> DEL	N	N	silent_mutation	Average:17.088; most accessible tissue: Callus, score: 34.518	N	N	N	N
vg0910385915	T -> C	LOC_Os09g16980.1	upstream_gene_variant ; 4065.0bp to feature; MODIFIER	silent_mutation	Average:17.088; most accessible tissue: Callus, score: 34.518	N	N	N	N
vg0910385915	T -> C	LOC_Os09g16990.1	downstream_gene_variant ; 1.0bp to feature; MODIFIER	silent_mutation	Average:17.088; most accessible tissue: Callus, score: 34.518	N	N	N	N
vg0910385915	T -> C	LOC_Os09g16995.1	downstream_gene_variant ; 2201.0bp to feature; MODIFIER	silent_mutation	Average:17.088; most accessible tissue: Callus, score: 34.518	N	N	N	N
vg0910385915	T -> C	LOC_Os09g16980-LOC_Os09g16990	intergenic_region ; MODIFIER	silent_mutation	Average:17.088; most accessible tissue: Callus, score: 34.518	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910385915	NA	1.34E-08	mr1092_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910385915	NA	8.95E-06	mr1097_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910385915	NA	6.31E-07	mr1152_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910385915	NA	2.53E-07	mr1154_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910385915	NA	8.96E-06	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251